ID: 1080896661

View in Genome Browser
Species Human (GRCh38)
Location 11:36453880-36453902
Sequence CAAGCTCCTCCCCTTGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 292}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080896661_1080896670 -4 Left 1080896661 11:36453880-36453902 CCCAGGCCAAGGGGAGGAGCTTG 0: 1
1: 0
2: 5
3: 25
4: 292
Right 1080896670 11:36453899-36453921 CTTGGGAGGGTTTGGAGGACAGG 0: 1
1: 0
2: 6
3: 42
4: 405
1080896661_1080896673 14 Left 1080896661 11:36453880-36453902 CCCAGGCCAAGGGGAGGAGCTTG 0: 1
1: 0
2: 5
3: 25
4: 292
Right 1080896673 11:36453917-36453939 ACAGGAGGTGAGCAAGAGGAAGG 0: 1
1: 1
2: 2
3: 68
4: 653
1080896661_1080896669 -9 Left 1080896661 11:36453880-36453902 CCCAGGCCAAGGGGAGGAGCTTG 0: 1
1: 0
2: 5
3: 25
4: 292
Right 1080896669 11:36453894-36453916 AGGAGCTTGGGAGGGTTTGGAGG 0: 1
1: 0
2: 3
3: 47
4: 762
1080896661_1080896671 -1 Left 1080896661 11:36453880-36453902 CCCAGGCCAAGGGGAGGAGCTTG 0: 1
1: 0
2: 5
3: 25
4: 292
Right 1080896671 11:36453902-36453924 GGGAGGGTTTGGAGGACAGGAGG 0: 1
1: 0
2: 3
3: 69
4: 751
1080896661_1080896672 10 Left 1080896661 11:36453880-36453902 CCCAGGCCAAGGGGAGGAGCTTG 0: 1
1: 0
2: 5
3: 25
4: 292
Right 1080896672 11:36453913-36453935 GAGGACAGGAGGTGAGCAAGAGG 0: 1
1: 0
2: 3
3: 58
4: 629
1080896661_1080896674 25 Left 1080896661 11:36453880-36453902 CCCAGGCCAAGGGGAGGAGCTTG 0: 1
1: 0
2: 5
3: 25
4: 292
Right 1080896674 11:36453928-36453950 GCAAGAGGAAGGAGCGTTAGAGG 0: 1
1: 0
2: 5
3: 16
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080896661 Original CRISPR CAAGCTCCTCCCCTTGGCCT GGG (reversed) Intronic
900143787 1:1149527-1149549 CCACCTCCTCCCCTCGGGCTGGG - Intergenic
900290717 1:1922497-1922519 CCACCTCCTCCCCTGGGACTGGG + Intronic
900706351 1:4082565-4082587 CAGGCTCCTGCCATTGCCCTGGG + Intergenic
900791077 1:4681350-4681372 CAGCCTCCTTTCCTTGGCCTGGG - Intronic
901508724 1:9703294-9703316 CAAGCCAATCCCCATGGCCTGGG + Intronic
901849606 1:12007141-12007163 GAAGGCCCTCTCCTTGGCCTTGG - Exonic
903650306 1:24917934-24917956 CCAGCCCATGCCCTTGGCCTTGG - Intronic
903849470 1:26297367-26297389 CAGGCACCTCCCCTGGGCCCAGG - Intronic
904451079 1:30612053-30612075 CTTCCTGCTCCCCTTGGCCTTGG + Intergenic
905506650 1:38485235-38485257 CAAGCTGCTCCCCTGGCCCACGG - Intergenic
906669346 1:47643327-47643349 CAAGCCTCTCCCCTTGGTATAGG - Intergenic
907359053 1:53900088-53900110 GAAGCCCCTCTCCTTGTCCTTGG - Intronic
907453102 1:54559873-54559895 GAAGCTCCTCTCCTTGTCCTGGG + Intronic
912944903 1:114076693-114076715 TCAGTTCCTTCCCTTGGCCTTGG + Intergenic
913186497 1:116373985-116374007 CGCGCTCCTCCCCTTCCCCTGGG + Exonic
914944718 1:152053678-152053700 CCTGCTCCTCCCCGGGGCCTTGG + Intergenic
916789125 1:168109546-168109568 AAAGCTCCTCCCACTGGCATAGG + Intronic
920386382 1:205572636-205572658 CCAGCTTCTCCCCTTGAGCTGGG + Intronic
920669029 1:207988908-207988930 CAAGCTCTTCAGCTTAGCCTCGG + Intergenic
921440761 1:215182897-215182919 CAAGCTTTCTCCCTTGGCCTGGG + Intronic
921863164 1:220060764-220060786 CAAGCTGCTCCCCACTGCCTTGG - Intronic
924332413 1:242953380-242953402 CATGCTCCTCTCCTTTGCCGTGG - Intergenic
1063679358 10:8172234-8172256 CAAGCTCCCCCACATGGCATTGG - Intergenic
1067490267 10:46692249-46692271 CAAGAACATCCCCTTGCCCTAGG + Intergenic
1067522132 10:47015947-47015969 CCAGCCCATCCCCTTGTCCTTGG - Intergenic
1067604397 10:47648127-47648149 CAAGAACATCCCCTTGCCCTAGG - Intergenic
1068395167 10:56451184-56451206 CAAGAACATCCCCTTGCCCTAGG - Intergenic
1069473744 10:68715253-68715275 CAGGCTCCTCACCTTGACCTAGG - Intergenic
1069855096 10:71435828-71435850 CATGCTGCTCACCATGGCCTGGG + Intronic
1070525574 10:77293159-77293181 CAAACTCCTTCCCATGGCATTGG - Intronic
1070541461 10:77418297-77418319 CAATCTTCTCTCCATGGCCTGGG + Intronic
1070587797 10:77779850-77779872 CAGAGACCTCCCCTTGGCCTAGG + Intergenic
1073097286 10:100987547-100987569 CATGCTACTCGCCTTGACCTCGG - Intronic
1073152212 10:101319817-101319839 CATGCTCCTCCCTGTCGCCTAGG + Intergenic
1074251730 10:111757485-111757507 CAAGGTCCTTGCCTTGGCTTCGG + Intergenic
1074600804 10:114911484-114911506 TAAGCTCCTACCTTTGGCCAGGG + Intergenic
1074766077 10:116700915-116700937 CAAGCCTCTCCCCTGGGCCCAGG - Intronic
1075200816 10:120402410-120402432 AATGCTCTTCCCCTTGCCCTAGG - Intergenic
1076449512 10:130547050-130547072 GGAGCTGCTCCCCTAGGCCTTGG + Intergenic
1076810243 10:132882687-132882709 CAAGGTCCTGCCCTTAGCCCGGG + Intronic
1076928694 10:133511545-133511567 CCAACTCCTCCCCTAGTCCTAGG - Intergenic
1077338240 11:2014842-2014864 CAAGGCCCACCCCTGGGCCTAGG - Intergenic
1078514253 11:12009061-12009083 CAGCCCCCTCCCCTTGGCGTCGG + Exonic
1080125585 11:28729614-28729636 CAACATCCTCGCCTGGGCCTTGG - Intergenic
1080896661 11:36453880-36453902 CAAGCTCCTCCCCTTGGCCTGGG - Intronic
1081633868 11:44707760-44707782 AAATGTCCACCCCTTGGCCTTGG - Intergenic
1081721057 11:45288644-45288666 CAAGCTCTTCTTCTTGGGCTGGG - Intergenic
1081742007 11:45447485-45447507 CAAGCTCTTCCCCTTGCTGTGGG - Intergenic
1081870501 11:46380855-46380877 CAAGCCCCTCCCCCAGGCCTCGG + Exonic
1083889780 11:65589964-65589986 CAGCCTCCTCCCCTGGGCTTGGG - Exonic
1084190592 11:67497028-67497050 GAAGCTCCTCCCAGTGGCTTTGG + Intronic
1085813918 11:79715466-79715488 CCATCCCCTCCCCTAGGCCTTGG + Intergenic
1086257470 11:84894813-84894835 CAATCTCCTGCCTCTGGCCTAGG + Intronic
1086670200 11:89537095-89537117 CAAGCTGCTCTCCTTGGCTCTGG - Intergenic
1088075191 11:105839625-105839647 CAAGCTCTACCTCTTGGGCTGGG - Intronic
1088325012 11:108592842-108592864 CGAGCTCCTACCCTTGGGGTGGG + Intronic
1088758514 11:112907311-112907333 CAAACCCCTCGCCTGGGCCTGGG - Intergenic
1089078687 11:115759457-115759479 CCAGCTTCTCCCCTTGGCTATGG - Intergenic
1089596926 11:119586357-119586379 CAGAGACCTCCCCTTGGCCTAGG - Intergenic
1089741861 11:120590047-120590069 CCAGCTCCAGACCTTGGCCTTGG - Intronic
1090653289 11:128824783-128824805 CAAGCTGCTCCCCGCGCCCTCGG - Intergenic
1090848697 11:130551558-130551580 CAAGCCCTTCCCCTTTCCCTTGG - Intergenic
1091226258 11:133957881-133957903 GAAGCTCCTTCCCTTTCCCTGGG - Intergenic
1202821224 11_KI270721v1_random:70024-70046 CAAGGCCCACCCCTGGGCCTAGG - Intergenic
1091549508 12:1527404-1527426 GAAGCTCCTCCCCCTGGCACTGG + Intergenic
1092872053 12:12813916-12813938 AAAGCACCTGGCCTTGGCCTTGG + Intronic
1096363011 12:51004489-51004511 CATCCTCCTCCCCTTGGGCTGGG + Intronic
1102579356 12:113876353-113876375 CTCTCTCCTCCACTTGGCCTCGG + Intronic
1103884136 12:124188292-124188314 CCAGCTCCTTCCCTTCTCCTGGG - Intronic
1103910709 12:124350541-124350563 CACACTCCTCCCCTGGTCCTGGG + Intronic
1104084038 12:125458233-125458255 CAGGCTCCATCCCTTGTCCTTGG - Intronic
1104400416 12:128471476-128471498 CAAGCTCTGCCCCTGGCCCTAGG + Intronic
1104671780 12:130685902-130685924 TAAGCTCCTCTCCTTCCCCTAGG + Intronic
1106034788 13:26033764-26033786 CAAGCCCCTCCCCTTGAACCTGG - Intergenic
1110784633 13:79509608-79509630 ACAACTCCTCCCCTTGGCCAAGG - Intronic
1111708881 13:91785908-91785930 CTTGCTCCTCCCCCTGCCCTGGG + Intronic
1112884403 13:104151046-104151068 ATAGCTCCTGCCCTTGGACTCGG - Intergenic
1113698557 13:112365877-112365899 CCAGCTCCACCCCTTAGCCCTGG + Intergenic
1114614822 14:24062756-24062778 ACAGATCCTGCCCTTGGCCTGGG - Exonic
1115807870 14:37072531-37072553 CGAACTCCTGACCTTGGCCTTGG - Intronic
1117444911 14:55794866-55794888 TAAGCTCCTCCCCTTGCCTGGGG - Intergenic
1118892893 14:69924536-69924558 CAGACTCCTCACCATGGCCTGGG + Intronic
1118925933 14:70189472-70189494 TCAACTCCTCCCCTAGGCCTGGG - Intergenic
1119539969 14:75431598-75431620 CCAGCACCTGCCCTCGGCCTCGG - Intronic
1120163021 14:81165520-81165542 CATGCTCCTCCATGTGGCCTGGG - Intergenic
1122199763 14:100115321-100115343 CAAGCCCCTGCCCTTTCCCTGGG + Intronic
1122347150 14:101067621-101067643 CAGGCCCCTTCCCTTGGGCTTGG + Intergenic
1123032556 14:105458749-105458771 CATGGTCCTCTCCTGGGCCTCGG - Intronic
1124403258 15:29369302-29369324 CAAGCTTCTCTCTTTGGCCTTGG - Intronic
1124711088 15:32012492-32012514 CAACCTCCATCCCTTGCCCTTGG + Intergenic
1126187955 15:45848784-45848806 GAAGCTCTTCCCTCTGGCCTTGG + Intergenic
1126666164 15:51077789-51077811 CAGGCTCCTCCCCCTGCCCAAGG - Intronic
1127149264 15:56056760-56056782 CAATCTCCTCCCCTTGGGAATGG - Intergenic
1128055907 15:64700035-64700057 CAGGCTCCTCCACTTGGCCTGGG - Intronic
1129410505 15:75348086-75348108 CGAGCTCCTGCCCCGGGCCTGGG - Intronic
1129504740 15:76071841-76071863 AAAGCTCCTCCCCCTGCCCTGGG - Intronic
1129614113 15:77084354-77084376 CTGGCTTCTCCTCTTGGCCTCGG + Intergenic
1132564982 16:617948-617970 CAAGCTCCTCACATGAGCCTGGG - Intronic
1132608339 16:802748-802770 CCTCCTCCTGCCCTTGGCCTTGG - Intergenic
1132746431 16:1438230-1438252 CAAGCTCCCCTCCCTGGCCCAGG - Intronic
1132917258 16:2357138-2357160 CAAGATTCTCTCCTTGGGCTGGG + Intergenic
1133821967 16:9244987-9245009 CAAGCTCCTCATTGTGGCCTTGG - Intergenic
1133824228 16:9262598-9262620 CAATCTCCTCCCCTTTGAGTGGG - Intergenic
1134165651 16:11927409-11927431 CAACCTCCGCCTCTTGGGCTCGG + Exonic
1137306688 16:47207593-47207615 CAAGCTCATCCCCTCTCCCTGGG - Intronic
1138412443 16:56851066-56851088 TCAGCCCCTCCCCTTTGCCTGGG + Intergenic
1141341333 16:83206370-83206392 CATGCCCAGCCCCTTGGCCTGGG - Intronic
1141464051 16:84195249-84195271 CAAGCTCCTTGCCTTAGGCTGGG + Exonic
1141646621 16:85371141-85371163 CAGTCAGCTCCCCTTGGCCTGGG - Intergenic
1142287675 16:89177999-89178021 CCAGCTCCTAGCCTGGGCCTTGG - Intronic
1142361563 16:89630095-89630117 CTAGCTCCACCCCTGGGTCTGGG + Intronic
1142865777 17:2790694-2790716 CAAGCTCCTTCCCCAGGCATGGG - Intronic
1143656262 17:8295473-8295495 AGAGCTCCTCCCTTTGGCCGCGG - Intergenic
1143839805 17:9723242-9723264 TAAGATGCTCCCCTTGACCTTGG + Intronic
1143858577 17:9871247-9871269 CAAGCCCCTCACCTTAGCCTGGG - Intronic
1146137376 17:30334768-30334790 CAATCTGCCCACCTTGGCCTAGG + Intergenic
1146653821 17:34623475-34623497 CACGCTCCTCCCTCTGGGCTGGG - Intronic
1146705691 17:34999223-34999245 CAAGGTCCTCTCCCTGGCCCTGG + Intronic
1147987162 17:44313242-44313264 CAGGCCCCTCACCTTGGCCCGGG - Exonic
1147997326 17:44367810-44367832 CAAAGTCCTCCCCATGGCCACGG + Intergenic
1150959211 17:69895727-69895749 CCAACTCCTTCCCGTGGCCTAGG - Intergenic
1152568338 17:81110184-81110206 CACACACCTCCCCGTGGCCTGGG + Intronic
1152615160 17:81334503-81334525 ACAGCTCCTCCCCTTCCCCTGGG - Intergenic
1152754722 17:82082469-82082491 CAGGGTCCCCCCCTTGGTCTTGG + Intronic
1154060363 18:11054798-11054820 CATGCTCCTCTCCCTGGGCTTGG - Intronic
1156480349 18:37432340-37432362 CAAGCTCCCCCTCTGGGCCCAGG - Intronic
1156864777 18:41876493-41876515 CAAGGTCTGCCCCATGGCCTTGG + Intergenic
1157053651 18:44198955-44198977 CCAGGTCCACTCCTTGGCCTTGG - Intergenic
1157310945 18:46552762-46552784 CAAGCTCCTCAGCATGGCTTTGG + Intronic
1157610613 18:48952611-48952633 CGCTCTCCTCCCCTTGCCCTCGG - Intergenic
1158513664 18:58113505-58113527 CAAGCTCCTCCCCTTCCTTTAGG - Intronic
1160563633 18:79773682-79773704 CATGTTCCTCCCCTTACCCTGGG - Intergenic
1160801871 19:974108-974130 CAACCACCTCCCCATTGCCTTGG + Exonic
1160860503 19:1235489-1235511 CCAGCACCTCACCTTGGGCTGGG + Exonic
1161245841 19:3251398-3251420 CATGGTCCTCCCCCGGGCCTTGG - Intronic
1161479891 19:4505231-4505253 CCAGCTCCTCACCATGGCCTTGG + Intronic
1161735299 19:5988569-5988591 CCAGCTCCTCCCCGGGACCTAGG + Intergenic
1161898265 19:7099037-7099059 TCGGCTCCTCCCATTGGCCTTGG - Intergenic
1163254042 19:16144074-16144096 CAAGCTCCTGACCCTGGCCTGGG - Intronic
1163748176 19:19060262-19060284 CAGCGTCCTCCCCTGGGCCTGGG + Intronic
1165419891 19:35717604-35717626 CAGGCTCCTCCCATTGTTCTTGG - Intergenic
1165806146 19:38582001-38582023 CAACCTCCTCCCTATGCCCTGGG + Intronic
1166840202 19:45692628-45692650 CAAGTTCCTCCCCATGGAATCGG - Exonic
1166861777 19:45815560-45815582 TCAGCTGTTCCCCTTGGCCTCGG + Exonic
1167709663 19:51102621-51102643 CAGGTTCCTCGCCATGGCCTGGG + Intronic
1167800746 19:51739771-51739793 CAAGCTCCTCTCTGTGCCCTGGG + Intergenic
1168165820 19:54546866-54546888 CATGATCCTCCCTTTGGCCCAGG - Intergenic
1168275826 19:55277786-55277808 CCACCTCCTCCCGCTGGCCTCGG + Exonic
1168289942 19:55352719-55352741 CAAGCGGCACTCCTTGGCCTGGG + Exonic
925146478 2:1586363-1586385 AAAGCTCTGCCCCTTGGGCTTGG + Intergenic
925276342 2:2650984-2651006 CAGGATCCTGCCCTTGGCATCGG - Intergenic
926797896 2:16633863-16633885 CATGCTCCTACCCTTCCCCTGGG + Intronic
927501150 2:23584193-23584215 CCAGCTGCTCCCCTGGGCCTGGG + Intronic
927889564 2:26739857-26739879 CAGCCTCCTCCCCTGGGCCAGGG - Intergenic
928175076 2:29027952-29027974 CCAACTCCTGACCTTGGCCTAGG - Intronic
928655021 2:33441395-33441417 CAACCTCCTCTCCTTGTCCCTGG + Intronic
932618642 2:73252436-73252458 CCAACTCCTCCCCTTAGCCCTGG - Intronic
932660025 2:73643771-73643793 CAATGTCCTCCCCTTGCTCTTGG - Intergenic
932666595 2:73703428-73703450 CAATGTCCTCCCCTTGCTCTTGG - Intergenic
935130079 2:100255122-100255144 CAAGCTCCTACCCTTGCCTCAGG + Intergenic
935149027 2:100417403-100417425 TAGGCTCCTCCCCTGGCCCTGGG + Exonic
936956668 2:118029299-118029321 CAAGCGCCTCCCCTTGACTTGGG - Intergenic
937015937 2:118605518-118605540 CAAGAATCTACCCTTGGCCTTGG + Intergenic
937955714 2:127420756-127420778 CATGCTTCTCCCCTTGGGCAGGG - Intronic
938071566 2:128311112-128311134 CAACCTCATCCCCTAGGTCTAGG + Intronic
942322291 2:174746179-174746201 CACCCTCCTCCTCTTGCCCTTGG + Intergenic
942595553 2:177588924-177588946 CAAGCTCCTGTCATTGGCCTAGG + Intergenic
944581541 2:201137041-201137063 CAGAGACCTCCCCTTGGCCTAGG + Intronic
944929349 2:204500657-204500679 CAGGCTCATCCCCTGAGCCTGGG - Intergenic
945197965 2:207255135-207255157 CAAACCCTTCCCCATGGCCTGGG + Intergenic
946405979 2:219492330-219492352 CCAGCTCCTCCCCTGCTCCTAGG + Intronic
946774669 2:223125040-223125062 CAAGGTCCTGCCCTTGCCCCAGG - Intronic
947722823 2:232379945-232379967 CCAGCCCCAGCCCTTGGCCTGGG - Intronic
947812058 2:233010894-233010916 AAAATTCCTTCCCTTGGCCTGGG - Intronic
947864158 2:233384608-233384630 CTGTCTCCTCCCCTTCGCCTCGG + Intronic
948831271 2:240599324-240599346 CAACCTCAGCCCCCTGGCCTGGG - Intronic
948982902 2:241503896-241503918 CCAGCTCCTCCGCTGGGCTTAGG - Intronic
949060519 2:241953850-241953872 CTGGCTCCTCCCCCCGGCCTGGG - Intergenic
949076145 2:242059337-242059359 CAGACTCCTCCCCTTGGCCAAGG + Intergenic
1171492336 20:25529945-25529967 CATCCTGCTCCCCTTTGCCTGGG - Intronic
1172655176 20:36532463-36532485 CAGTCTCCTCACCTTGGCCTTGG + Intergenic
1173666561 20:44767310-44767332 CTAGCTCCTGCCCTTTTCCTGGG + Intronic
1174163470 20:48568099-48568121 CAAGCTCCTCACCATGGCCTTGG - Intergenic
1175115168 20:56676946-56676968 CAAACGCCTCCCCTTGTCCATGG - Intergenic
1176066201 20:63197309-63197331 CATGCTCTTCCCCTTGGCGTGGG - Intronic
1177172854 21:17672836-17672858 CCATCTCCTCTCCTTGGGCTCGG - Intergenic
1178387321 21:32163490-32163512 CAAGGTCATAACCTTGGCCTGGG - Intergenic
1180019302 21:45111175-45111197 CAGGCTCCTCCTGTTGGCGTGGG + Intronic
1180938291 22:19640293-19640315 CATTCTCCTCCCCTTGCCCCTGG + Intergenic
1181665818 22:24396025-24396047 CAAGATTCTGCTCTTGGCCTTGG + Intronic
1182279287 22:29208720-29208742 CAAGGTCTTCCCCTTGGAATAGG - Intronic
1183305013 22:37078149-37078171 CAAGCGCATCCCATGGGCCTTGG + Intronic
1183524030 22:38313461-38313483 CTCAGTCCTCCCCTTGGCCTGGG - Intronic
1184490292 22:44804394-44804416 TGAGCTTCTCCCCTGGGCCTGGG - Intronic
1184649927 22:45915080-45915102 CACACTCCTCCTCTAGGCCTCGG - Intergenic
950634266 3:14303881-14303903 CTGGCTCCTCCCCTTGGCTTTGG + Intergenic
950674478 3:14546287-14546309 CCAACTCCTCTCCCTGGCCTCGG - Intergenic
952233515 3:31455718-31455740 AAGGCTCCTCCCCCTGGCCCCGG - Intergenic
952719121 3:36514099-36514121 CAATGTCCTCCCATTGCCCTGGG + Intronic
952759863 3:36904295-36904317 CGAACTCCTCGCCTCGGCCTCGG - Intronic
954681696 3:52349538-52349560 CCAGCTCCTTCCCTTGGCCTGGG - Intronic
954961517 3:54569496-54569518 CCAGCTCCTTCCCTTGGCTAGGG - Intronic
959741366 3:109724028-109724050 CAAGGGCCTTCCCTTGGGCTAGG - Intergenic
960886787 3:122404044-122404066 CAAGCTCCTCACCGTTTCCTTGG + Intronic
961376554 3:126469946-126469968 CAAGCTGCTTCTCTGGGCCTTGG - Intronic
961823495 3:129587013-129587035 CAAGCCCCTGCCCTTAGCCATGG - Intronic
965315454 3:167184422-167184444 CAAGCCACCCCGCTTGGCCTTGG + Intergenic
965487750 3:169299292-169299314 CCAGCCCCTCCTCTTGGCCTCGG - Intronic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
966930620 3:184673260-184673282 CAAGCTCCTCCCTGTGGGCCGGG + Intronic
967219662 3:187237801-187237823 CAGGCTACACTCCTTGGCCTGGG + Intronic
967367571 3:188705012-188705034 CAGGGTCCTTCACTTGGCCTGGG + Intronic
968493266 4:901734-901756 CCTCCTCGTCCCCTTGGCCTGGG + Intronic
969320428 4:6409305-6409327 CAAGCAGGTCACCTTGGCCTAGG + Intronic
971108974 4:23561127-23561149 CAACCCCCTCCACTTTGCCTTGG - Intergenic
972936900 4:44147314-44147336 TAAGCTGCTTTCCTTGGCCTGGG + Intergenic
973001996 4:44962419-44962441 CAAGTGCTTTCCCTTGGCCTGGG + Intergenic
974748211 4:66103173-66103195 GAAGCTCCTCCCCTGTGCCTTGG - Intergenic
976334554 4:83870518-83870540 CCAGCACCTCCCATTGGCCAAGG - Intergenic
977178051 4:93839356-93839378 CAAGCCAATCCCCTTGGTCTGGG - Intergenic
977569136 4:98611858-98611880 CCAGCTCCATCCCCTGGCCTGGG + Intronic
978947256 4:114515087-114515109 CAATCTCCTGACCTCGGCCTTGG - Intergenic
980495660 4:133585686-133585708 CAAGCTGGTCTCCTTGGCCAGGG - Intergenic
981577855 4:146223471-146223493 CCAGCTTCTGCCCTTGGCTTTGG + Intergenic
981747169 4:148063131-148063153 CAAACTCCTACCCTTAGCCCAGG + Exonic
984610783 4:181834577-181834599 CAAGTTCCTGCCCTCAGCCTGGG + Intergenic
984619596 4:181937281-181937303 CAAACTCTTCCTCTTGGCCTAGG - Intergenic
985781803 5:1875577-1875599 CCAGCCCCTCCCCGTGGCCCTGG - Intergenic
986749726 5:10776168-10776190 CAAGATCCTCAGCTTAGCCTGGG + Intergenic
987742187 5:21924292-21924314 CAAACTCCTGACCTCGGCCTCGG - Intronic
992612669 5:78520673-78520695 CCAGCTCCCACCCTTGGCCAGGG - Intronic
995478558 5:112572397-112572419 CAATCTCCTCCACTTGGCCTAGG + Intergenic
996579713 5:125017855-125017877 GTAGCCCCTCCCCTTGGCTTTGG - Intergenic
997740150 5:136246023-136246045 AAAGCTCCTCCCCTGGGGATGGG - Intronic
998295122 5:140962106-140962128 CGATCTCCTAACCTTGGCCTCGG + Intronic
998641300 5:144014385-144014407 CAACATCCTTTCCTTGGCCTGGG - Intergenic
999195663 5:149779904-149779926 CCAGCCCCTTCCCCTGGCCTTGG + Intronic
999305660 5:150517941-150517963 CCAGCCCCACCCCTTGGCCTAGG - Intronic
999321716 5:150619357-150619379 CACGTTCCTCGCCTAGGCCTTGG + Intronic
999467987 5:151825171-151825193 CCAACTCCTCTCCTTGGCCCTGG - Intronic
999735032 5:154506549-154506571 CAGGCTCCGCCCCTGGGACTGGG - Intergenic
1000027525 5:157372833-157372855 CACCCTCCTCCCATTGGCCGTGG + Intronic
1000121601 5:158203273-158203295 AAGGCTCCTGCCATTGGCCTGGG + Intergenic
1001339746 5:170832317-170832339 CACGCTCCTCCACTTTTCCTTGG + Intergenic
1003401391 6:5794042-5794064 CAAGCTCCTGCCCTCTACCTTGG - Intergenic
1003590316 6:7431816-7431838 CCAGCTCCTCCCCCTGGCTTAGG - Intergenic
1004195916 6:13505279-13505301 CAAGCTCCTGCCTTTAGTCTGGG - Intergenic
1006188214 6:32192194-32192216 CAAACTCCACCACTCGGCCTTGG - Exonic
1006580124 6:35072286-35072308 CATGCTCCTTCCGTTCGCCTGGG + Intronic
1007714800 6:43849565-43849587 CAACTTCCTCCCCTTGCTCTGGG + Intergenic
1008354509 6:50535389-50535411 CAAGATCCTCCACTTGACCCTGG + Intergenic
1009733347 6:67639327-67639349 AAATCTCCTCCCCTAGGCCCTGG - Intergenic
1009946415 6:70346853-70346875 CCAGGGCCTCCCCTTGCCCTTGG - Intergenic
1011516957 6:88165934-88165956 CCAGCGCCTTCCCTTGGCCCGGG - Exonic
1012410288 6:98948137-98948159 AAAGCTCCTCCCCCTGGCCTGGG - Intergenic
1012432386 6:99178293-99178315 CAGACTCCTCCTCTTGGCCAAGG + Intergenic
1013314101 6:108924654-108924676 CAAACTCATCTCCTTTGCCTCGG - Intronic
1018757197 6:166860522-166860544 CAAGCTGCTCCTCATGGCTTTGG + Intronic
1019547616 7:1586075-1586097 CCAGCTCCTACCCTCTGCCTGGG + Intergenic
1019574106 7:1728013-1728035 CAAGCACCACCCCTTTGCATGGG + Intronic
1020086801 7:5314976-5314998 CAACCTACCACCCTTGGCCTTGG + Exonic
1022665802 7:32409115-32409137 CAATCTGCCCACCTTGGCCTAGG - Intergenic
1023103588 7:36742897-36742919 CAAGCTCTTCCCCTTGAGCAAGG + Intergenic
1024204190 7:47141411-47141433 GATGCTTCTCTCCTTGGCCTTGG + Intergenic
1027156477 7:75771938-75771960 CAAGCCCCTTCCCTGGACCTGGG - Exonic
1029291442 7:99504959-99504981 CAAGCTCCTCCCCTTTCCGTGGG - Exonic
1029652495 7:101903139-101903161 CCTGCCCCTCCTCTTGGCCTCGG - Intronic
1030515669 7:110534670-110534692 CAGGCTTCTCCCCGGGGCCTGGG + Intergenic
1032011695 7:128351629-128351651 CAAGCTCTTCCGCTTGTCCCCGG - Exonic
1032018103 7:128392533-128392555 CAGAGACCTCCCCTTGGCCTAGG + Exonic
1033097362 7:138442675-138442697 CAGAGACCTCCCCTTGGCCTAGG - Intergenic
1033280207 7:140001099-140001121 GCAGCGCCTCCCCTTGACCTTGG - Intronic
1034939025 7:155218518-155218540 CCAGCTCCTTCCCTCAGCCTGGG - Intergenic
1036107672 8:5858082-5858104 CAATCTTCTCCCCCTGCCCTAGG + Intergenic
1038433469 8:27518546-27518568 GTCTCTCCTCCCCTTGGCCTTGG - Intronic
1041722458 8:60988407-60988429 CAAGCTGCTCCCGTGGGCCCGGG + Intergenic
1042121177 8:65490066-65490088 CCTGCTCCTCCCCTTCTCCTGGG + Intergenic
1042668997 8:71240197-71240219 CAAGCCCCTTTCCTTGGCCCTGG + Intronic
1047241311 8:123091544-123091566 CAAGCTCCTCCCTTCTTCCTTGG - Intronic
1048492064 8:134902950-134902972 CCAGAACCTCCCCTGGGCCTTGG + Intergenic
1048573777 8:135675604-135675626 TAAGCTGCTCCCTCTGGCCTGGG + Intergenic
1048955678 8:139534101-139534123 GAAGCCCCTCACTTTGGCCTGGG + Intergenic
1048956626 8:139542869-139542891 CAAGCCCCTGCCCTGGGTCTGGG - Intergenic
1049432175 8:142570250-142570272 CCAGCTCCTCCCCGTTTCCTAGG + Intergenic
1049455182 8:142683032-142683054 CAAGCTCCTACCCATCCCCTTGG + Intergenic
1049616724 8:143578731-143578753 CCAGCTCCTGCCCTGGGCCTGGG + Intergenic
1051320146 9:15894520-15894542 CAAACTTCTCACTTTGGCCTTGG + Intronic
1052941079 9:34132708-34132730 CAGAGACCTCCCCTTGGCCTAGG + Intergenic
1055787448 9:79885448-79885470 CATCCTCCTCCCCTTGCCCAGGG + Intergenic
1056260582 9:84844058-84844080 CAAACTCCTCACCTAGGCCTTGG - Intronic
1057524712 9:95788241-95788263 CCGGCTCCTCCCCTTGCTCTTGG + Intergenic
1057991188 9:99771856-99771878 CAATCTGCCCGCCTTGGCCTTGG + Intergenic
1059425138 9:114216275-114216297 CAAGCTCATTCCTTGGGCCTGGG + Intronic
1059677030 9:116549476-116549498 CAGGCTCCAGCCCTGGGCCTGGG - Intronic
1060860181 9:126947655-126947677 CAGGCTCCTCCCTGTGGCTTAGG - Intronic
1061499096 9:130992087-130992109 CCTGCTCCTCCTCTAGGCCTGGG - Intergenic
1061847741 9:133397329-133397351 GAAGCTCCTGTCCATGGCCTTGG + Intronic
1062012011 9:134272427-134272449 GTAGCTCCACCCCTTGGCTTCGG - Intergenic
1062111609 9:134785142-134785164 CAGGCCCTTCCCCATGGCCTCGG + Intronic
1062382537 9:136294443-136294465 GCAGCTCCACCCCGTGGCCTGGG + Intronic
1062402534 9:136378792-136378814 CAAGCCCCTGCCCTGGGCCCCGG - Exonic
1062444046 9:136585952-136585974 CCACCTCATCCCCCTGGCCTAGG - Intergenic
1062577887 9:137217037-137217059 CTAGCTCCTCCCGGTGCCCTGGG + Intergenic
1062577902 9:137217088-137217110 CTAGCTCCTCCCGGTGCCCTGGG + Intergenic
1062577918 9:137217139-137217161 CTAGCTCCTCCCGGTGCCCTGGG + Intergenic
1186664304 X:11702811-11702833 CAATCTCTTGGCCTTGGCCTTGG - Intergenic
1186800479 X:13087715-13087737 CCAACTCCTCCCCAAGGCCTAGG - Intergenic
1187445265 X:19355538-19355560 CAAGGACATACCCTTGGCCTTGG - Intronic
1187470105 X:19562078-19562100 CAGGCTCCTAACCTTGGCCAAGG + Intronic
1187930806 X:24292078-24292100 CAATCCCCTCCCCTGGGCTTTGG + Intergenic
1189658905 X:43277625-43277647 CAGAGACCTCCCCTTGGCCTAGG + Intergenic
1190883189 X:54507984-54508006 CAATCTACCCACCTTGGCCTCGG + Intergenic
1192231704 X:69269727-69269749 CACCCTGCTCCCCTTGGGCTTGG - Intergenic
1194524780 X:94966141-94966163 CAAGCTCCTCCAGTTAGTCTAGG + Intergenic
1194937884 X:99972944-99972966 TAAGCCTCTCTCCTTGGCCTTGG + Intergenic
1196135639 X:112206824-112206846 CCTACTCCTCCCATTGGCCTTGG + Intergenic
1196736716 X:118986856-118986878 CACCCTCCTCCCCTTCACCTGGG + Intronic
1197719445 X:129735140-129735162 CAAGCTCCTGCCCTTGGGGATGG + Intergenic
1197971334 X:132118520-132118542 CAAGCTCCTCCCCCTGCCCATGG + Intronic
1198112556 X:133514489-133514511 CAAACTCTCCCTCTTGGCCTTGG - Intergenic
1198453509 X:136792242-136792264 CAAGATCCTCAACTTGGGCTGGG + Intergenic
1198830342 X:140743817-140743839 CCACCTCCTCCTCTTGACCTTGG + Intergenic
1200354146 X:155530406-155530428 CATGCCCCTACCCTTGGCCCTGG - Intronic