ID: 1080896678

View in Genome Browser
Species Human (GRCh38)
Location 11:36453965-36453987
Sequence CAGAGTTGCAAGGAAGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080896678 Original CRISPR CAGAGTTGCAAGGAAGCTGA TGG Intronic
900250720 1:1667482-1667504 CAGAAGTGGAAAGAAGCTGAAGG + Intronic
900261687 1:1733842-1733864 CAGAAGTGGAAAGAAGCTGAAGG + Intronic
900341399 1:2191002-2191024 CAGAGTGAGAAGGCAGCTGATGG - Intronic
901692482 1:10982444-10982466 CAGAGTTCAAAAGGAGCTGAGGG + Intergenic
902492452 1:16794348-16794370 CAGAGTTGCCAGGACTCTCATGG - Intronic
902519251 1:17006661-17006683 CAGAGCTCCAAGGAAGCTAATGG - Intronic
903548429 1:24141483-24141505 CTGGGTTGCAAGGAGGCTGGTGG + Intronic
903999919 1:27333065-27333087 GTGAGTGGCAGGGAAGCTGATGG - Intronic
904890281 1:33774413-33774435 CAGAGCTCCAGGGAATCTGAAGG + Intronic
905784843 1:40746646-40746668 CAGAGCTGCAATGAAGAGGAAGG - Intronic
914870553 1:151470409-151470431 GAGAGTTGAAAGGAGGTTGAGGG - Intergenic
915982311 1:160427961-160427983 CAGAGTGGCGAGGTAGGTGAAGG - Exonic
917515585 1:175704983-175705005 CAGAGATGCAAAGAAGATAATGG + Intronic
917796609 1:178537561-178537583 CTGAGTGGCAAGGAAGTTGCAGG - Intronic
918435227 1:184504262-184504284 AACAGGTGCAAGGAAGCTGGGGG + Intronic
918545174 1:185674105-185674127 CAGTGTTCCAAAGAAGCTGAAGG - Intergenic
920838753 1:209536145-209536167 CAGAATTGCCAGGAGGCAGAGGG + Intergenic
921101254 1:211931264-211931286 CAGAATAGCCAGGGAGCTGATGG + Intergenic
923527997 1:234788188-234788210 CAGAGTTGCCAGGACTCTCATGG + Intergenic
923805798 1:237256527-237256549 CAGAGAACCAAGGAAGGTGAAGG - Intronic
924261660 1:242237718-242237740 CAGGCATGCAAGGAAGCAGAGGG - Intronic
1064352829 10:14592341-14592363 CAGAGTTGCTACGAACCTGCTGG - Intronic
1065042180 10:21708452-21708474 CTGAGGAGCAAGGAAGTTGAAGG + Intronic
1068166093 10:53334288-53334310 CAGAGTAAAAAGGAATCTGAAGG - Intergenic
1069032909 10:63617054-63617076 CAGTGTGGCAAGGAAGGGGATGG - Intronic
1071346628 10:84699905-84699927 AGGAGTTGGAAGGAAACTGATGG - Intergenic
1072268702 10:93754902-93754924 CAGAGTTGGAAGGAGGCCCAGGG - Intergenic
1073301646 10:102474607-102474629 CAGTGTTGGAAGCAAGCTGTTGG + Intronic
1074357657 10:112800243-112800265 CAGAGCTGCAGAGGAGCTGAAGG + Intronic
1074687989 10:115977349-115977371 CACAGATGCAGGGAAGATGAAGG + Intergenic
1074891290 10:117738538-117738560 CAGAGCTGCAACAAAGCTGCGGG - Intergenic
1075282382 10:121150687-121150709 CAGAGTCTCAAGGAAGCATATGG - Intergenic
1077350807 11:2092392-2092414 CATAGTTGCTAGGAGGGTGAAGG - Intergenic
1077519272 11:3022128-3022150 TAGAGCTGCAGGGAAGCGGATGG - Intronic
1077976130 11:7251204-7251226 GAGAGTTGGAAGGAACCTCAGGG - Intronic
1077997802 11:7468955-7468977 CAGAGTTGCAAATGGGCTGAGGG - Exonic
1078490010 11:11759903-11759925 GAGAGATGCAAGGAAACTGAGGG + Intergenic
1079313172 11:19384599-19384621 CACTTTTGCAAGGAAGGTGAGGG - Intronic
1079590488 11:22177310-22177332 CTCAGTTGCCAGAAAGCTGAGGG + Intergenic
1079651378 11:22934272-22934294 CAACCTTGTAAGGAAGCTGAAGG + Intergenic
1080108174 11:28534340-28534362 AAGAGTTGTAAGGAAGAAGATGG - Intergenic
1080332265 11:31153251-31153273 CAGAGTTGTAAGGAAGGGGATGG - Intronic
1080896482 11:36452567-36452589 CAGAGTTTCAATGACACTGAAGG + Intronic
1080896678 11:36453965-36453987 CAGAGTTGCAAGGAAGCTGATGG + Intronic
1086914262 11:92510760-92510782 GAGAGCTGCAAGGAAGATTAAGG - Intronic
1088354379 11:108927090-108927112 TAAAGCTGCAAGGAAGCTAAGGG - Intronic
1089403650 11:118180217-118180239 CAGAGTTGCCAGAAGGCAGAAGG + Intergenic
1090740142 11:129651957-129651979 GGAAGTAGCAAGGAAGCTGATGG + Intergenic
1091074847 11:132605915-132605937 CAGAGCTGAAAGGAAGCTGCTGG - Intronic
1092095157 12:5836011-5836033 CAGAGTGGGAGGGAAGCTGATGG + Intronic
1092725098 12:11477134-11477156 CAGAGCTGCAAGAAGGCTAAAGG + Intronic
1095144320 12:38706870-38706892 CAGTGCTTCTAGGAAGCTGACGG - Intronic
1095867186 12:46984542-46984564 ATGAATTGCAAAGAAGCTGAAGG + Intergenic
1096928158 12:55172769-55172791 CAGAGATTCAAGGAAGATAAGGG - Intergenic
1096957946 12:55546094-55546116 CAGAGTCGCAAGGTGGCTCAGGG + Intergenic
1097349124 12:58528225-58528247 CAGAGTGGTTGGGAAGCTGAGGG + Intergenic
1100396328 12:94189215-94189237 GAGAGTGGCCAGGGAGCTGAGGG + Intronic
1100988625 12:100228679-100228701 CTGAGTTAGAAAGAAGCTGAGGG + Intronic
1101819173 12:108169961-108169983 CAGGGTGGCCAAGAAGCTGAAGG + Intronic
1102609341 12:114097676-114097698 CAGAGTGGGAAGGTATCTGAAGG + Intergenic
1102739821 12:115197202-115197224 CAGGGTTGCAAGGAAGCATCAGG - Intergenic
1102770260 12:115470197-115470219 TAGTGTTTAAAGGAAGCTGAGGG - Intergenic
1104437742 12:128769235-128769257 CCATGTTGTAAGGAAGCTGAGGG - Intergenic
1106016975 13:25878865-25878887 GAGAGTGGGAAGGCAGCTGATGG - Intronic
1109721736 13:66283951-66283973 TAGAGTTGCAAAGAACATGATGG - Intergenic
1109721739 13:66283998-66284020 TAGAGTTGCAAAGAACATGATGG - Intergenic
1110454363 13:75673505-75673527 CAGGGTTGCAAGGTAGCTGTTGG - Intronic
1110545133 13:76747458-76747480 CAGAGCTGGGAGGAAGATGATGG + Intergenic
1110562332 13:76922914-76922936 CTGAGTTGGGAGGAAGCTCATGG - Intergenic
1112248858 13:97759965-97759987 TAGTGTTGCAATGAACCTGAGGG + Intergenic
1113557362 13:111249133-111249155 CAGAGTTGCTGGGAAGCTGGGGG - Intronic
1115144921 14:30215404-30215426 AAGAGTAGCAAGGAGGCGGATGG - Intergenic
1115353665 14:32424427-32424449 CAGAGATGGAAGGGAGGTGAAGG - Intronic
1116888125 14:50240357-50240379 CAGAGTTGAAGGGAATCTGGAGG - Intronic
1117277821 14:54207363-54207385 CAGAGTTTCAAAGAAGTTGTAGG + Intergenic
1118595080 14:67429006-67429028 CAGAGTTAGAAGGAATGTGAAGG + Intergenic
1119197289 14:72726471-72726493 TAGAGTCACAGGGAAGCTGATGG - Intronic
1119682460 14:76603121-76603143 CAGAGTTGGAAGGGACCTTAAGG - Intergenic
1120578473 14:86215655-86215677 CAAGGTTGCAATCAAGCTGATGG + Intergenic
1120597751 14:86462333-86462355 CAAAATTGCAAGTATGCTGAGGG - Intergenic
1121217524 14:92260120-92260142 CAGAATGGCAAGGCAGCTAAGGG - Intergenic
1121423659 14:93833148-93833170 CAAAGTTCCAAGGGAGCTGTTGG - Intergenic
1121931713 14:97978219-97978241 GAGAGTTGCAGGGAAGCAGCAGG + Intergenic
1122940586 14:104979251-104979273 CAGGGCAGCAAGGAGGCTGAGGG + Intergenic
1123149142 14:106164842-106164864 CAGAGTTGTGAGGAAGCTCAGGG - Intergenic
1123152457 14:106196337-106196359 CAGAGTCGTGAGGAAGCTCAGGG - Intergenic
1123172621 14:106389035-106389057 CAGAGTCGTGAGGAAGCTCAGGG - Intergenic
1124372367 15:29110977-29110999 CCGAGTGGCCAGGAAGCTGAGGG + Intronic
1124595556 15:31088921-31088943 CAGAATTGCGTGGAAGCTGCTGG + Intronic
1126325674 15:47474194-47474216 CTGAGTTGAGAAGAAGCTGAGGG + Intronic
1126365062 15:47885969-47885991 CAGAGTTACAAGGAAGCAGAGGG - Intergenic
1126431134 15:48586306-48586328 CAAAGTTGCATAGAAACTGATGG + Intronic
1126856100 15:52840912-52840934 GAGAGCTGCCAGGAATCTGAGGG + Intergenic
1127561161 15:60137775-60137797 CAGAGTGGGAAAGGAGCTGATGG + Intergenic
1128706501 15:69840967-69840989 TAGAGCTGGAAGGAAGCTGGGGG - Intergenic
1131060608 15:89401789-89401811 CAGAGCTGCACAGAGGCTGAGGG - Intergenic
1132316892 15:100896970-100896992 CAGAGCCGGAGGGAAGCTGAAGG + Intronic
1133109249 16:3535983-3536005 CAGAGTGGCAAGCAGGCTGTGGG - Intronic
1133436294 16:5782874-5782896 CAGGGATGCAAGGAAGAAGAGGG + Intergenic
1133973774 16:10585482-10585504 CAGAGTGGCAAGGAGGATGGAGG + Intergenic
1134915501 16:18067300-18067322 CAGATTTGGAAGCAACCTGAGGG + Intergenic
1136681077 16:31962720-31962742 CAGAGTCGTGAGGAAGCTCAGGG + Intergenic
1136888404 16:33949608-33949630 CAGAGTCGTGAGGAAGCTCAGGG - Intergenic
1137068768 16:35879253-35879275 CAAAGCTCCAAGGAAGCTAAAGG - Intergenic
1137750048 16:50854588-50854610 CTAAGTTGCAAAGATGCTGAGGG + Intergenic
1138659357 16:58508479-58508501 CAGAGCTGCTGGGAAGCTGCAGG + Intronic
1203084045 16_KI270728v1_random:1168214-1168236 CAGAGTCGTGAGGAAGCTCAGGG + Intergenic
1142767269 17:2071923-2071945 CACAGCTGCCAGGAATCTGACGG - Intronic
1143178675 17:4970887-4970909 GAGAGTTGAAAGGGAGCTGGGGG - Intronic
1143986886 17:10922427-10922449 GAGACATGCAAGGAAGTTGAAGG - Intergenic
1146638949 17:34525943-34525965 CAGAGGGGGCAGGAAGCTGAGGG + Intergenic
1147403012 17:40192187-40192209 CAGAGTTTGAAGGAAGGAGAAGG - Intronic
1147581382 17:41629092-41629114 AAGAGCTGCAAGGATGCCGAGGG - Intergenic
1148090538 17:45020332-45020354 CAGAGGAGCTAGGAAGGTGAGGG + Intergenic
1148812173 17:50300414-50300436 CAGAGCTGCTAGGGAACTGAAGG + Intergenic
1148838111 17:50477159-50477181 CAGACTTGTACTGAAGCTGAGGG + Intergenic
1148846678 17:50533783-50533805 CAGAGGAGGGAGGAAGCTGAGGG - Intronic
1149035901 17:52134260-52134282 CTGAGTAACAAAGAAGCTGATGG - Intronic
1149459097 17:56812747-56812769 CAAAGTTGGAAGCAAGCAGAGGG + Intronic
1149497130 17:57126116-57126138 CAGAGTGGCATGGCAGGTGAGGG + Intergenic
1150394737 17:64812418-64812440 CAGAGCTGCAAGGAGGCCGGTGG + Intergenic
1150551711 17:66216665-66216687 CAGACTTGCTAGGAAACTGCTGG - Intronic
1150838912 17:68590283-68590305 CAGAGTTGCAAGGAGGCCTCAGG + Intronic
1152565468 17:81098291-81098313 GAGAGTGGCGAAGAAGCTGAGGG - Intronic
1153174763 18:2358236-2358258 GAGGGTTGCAAGAAAGGTGAGGG - Intergenic
1154207201 18:12347345-12347367 CAGAGTTCCACGGAAGAGGAGGG - Intronic
1155436607 18:25819148-25819170 CAGAGTTGAACGGCATCTGATGG + Intergenic
1156516073 18:37681696-37681718 CAGAAGTGCAAGAAAGCAGAAGG + Intergenic
1157691949 18:49690927-49690949 CTGAGATGGGAGGAAGCTGAAGG - Intergenic
1157819695 18:50757189-50757211 CAGAGCTGAGAGGAAGCTCAGGG - Intergenic
1160423776 18:78766949-78766971 CAGAGTGGGGAGGACGCTGAAGG - Intergenic
1161016146 19:1984683-1984705 AACAGTTGCCAGGAGGCTGAAGG - Intergenic
1164405529 19:27942118-27942140 CAGACCAGCTAGGAAGCTGATGG + Intergenic
1164484455 19:28642962-28642984 ATGAGTTACAAGGAAGCAGAAGG + Intergenic
1164513534 19:28915838-28915860 CAGAGACCCAAGGAGGCTGAGGG - Intergenic
1164605124 19:29592473-29592495 CACAGTTTCATGGATGCTGACGG - Intergenic
1165158912 19:33804498-33804520 GAGAGTTCCCAGGAGGCTGAGGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166813347 19:45527114-45527136 CAGGGTGGGAAGGAAGATGAAGG - Intergenic
925294845 2:2769549-2769571 CAGGGTGGCAAGGAGGGTGACGG + Intergenic
926979583 2:18553959-18553981 CACATTTGAAAGGAACCTGAAGG + Intergenic
928222473 2:29415981-29416003 CAGAGATCCAGGGGAGCTGATGG - Intronic
928305680 2:30168533-30168555 CAGAGTGCCAAGCAAGCAGAAGG + Intergenic
931222972 2:60304953-60304975 TAGAGTAGGAAGGAACCTGAGGG - Intergenic
934497837 2:94824922-94824944 CAGTGTTGCAAAGATGCTGCAGG + Intergenic
935165169 2:100563419-100563441 CAGAGGTGTTAGGAAGCGGAGGG + Intronic
937223693 2:120356386-120356408 GAGAGCTGCAGGGCAGCTGAGGG - Intergenic
937862121 2:126719351-126719373 CATTGTTCCAAGGCAGCTGATGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938981436 2:136530890-136530912 CAGAGTTCCAAGGATGGTGCAGG + Intergenic
940927055 2:159375777-159375799 CAGAGGGGCAAGGGAGATGATGG + Intronic
941069532 2:160940422-160940444 CAGATGTGGGAGGAAGCTGAGGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941239585 2:163019452-163019474 CAGAGTTGCCAGCAACCTGTAGG - Intergenic
942018121 2:171838117-171838139 CAGAGTTGCAAAGAGTGTGACGG - Intronic
943357928 2:186882096-186882118 CAAAGTTACAAGGAACATGAAGG - Intergenic
944289086 2:197984417-197984439 CTGATTTCCAAGGAAGTTGAAGG + Intronic
944522143 2:200582707-200582729 CAAAGTTCCAAGGAAAATGAAGG + Intronic
944693387 2:202178871-202178893 CAAAGTTGCAAAGAAGCTCCTGG + Intronic
945506097 2:210642009-210642031 CAGAGCTGCAAGGCACCTCAGGG + Intronic
945749747 2:213766853-213766875 CAGTGTTGAAAGGAAGCTGCAGG - Intronic
946436414 2:219659091-219659113 CAGATGTGCAAGGAAGAAGATGG + Intergenic
947105424 2:226663430-226663452 CAGAGTTTCCAGGAAGTTGGGGG - Intergenic
947329041 2:229009086-229009108 AAGAGTTCCAAGGAAGATGAAGG - Intronic
948676571 2:239600511-239600533 CAGAGTGGGAAGGGGGCTGAGGG + Intergenic
1169300211 20:4435769-4435791 CAGCCTTGCACAGAAGCTGAAGG + Intergenic
1169616774 20:7456953-7456975 CAGAGTTTCAAGGCAGCTCTGGG - Intergenic
1170071625 20:12375304-12375326 CTGAGATGCACAGAAGCTGAAGG + Intergenic
1170748235 20:19120076-19120098 CTGAGGAGCAAGGAAGCTGGGGG + Intergenic
1171391975 20:24807440-24807462 CAGAGGTGCCAGGCAGTTGAGGG + Intergenic
1172874713 20:38157141-38157163 CAGAGCTGCAAGGAGGGAGATGG - Intronic
1174908224 20:54575234-54575256 CAGAGTTACAAAGAAACTCAAGG + Intronic
1175824369 20:61928655-61928677 CAGAGCTGCAAGGATGTTCACGG - Intronic
1176586182 21:8588761-8588783 CAGAGATGCAAGGATACTAATGG + Intergenic
1177216893 21:18141802-18141824 CAGAGAAGCAAACAAGCTGAAGG + Intronic
1178045723 21:28692166-28692188 CAGGGTTGCAAGGAATCTCATGG - Intergenic
1179296343 21:40066111-40066133 CAGAGGTCCAGGGAAGCGGAGGG - Intronic
1179409822 21:41153976-41153998 CAGAGTCGCAATGAGGCTGGAGG + Intergenic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1180207496 21:46270356-46270378 CAGAGTTGGAAGAAAGCAGGTGG - Intronic
1180268989 22:10565665-10565687 CAGAGATGCAAGGATACTAATGG + Intergenic
1181014583 22:20061793-20061815 CCCAGCTGCAGGGAAGCTGATGG + Intronic
1182556479 22:31131875-31131897 CAGATTGGCTCGGAAGCTGAGGG + Intronic
1182836856 22:33349155-33349177 CTGAGAACCAAGGAAGCTGATGG - Intronic
1183570256 22:38647978-38648000 CTGAGAGGCAAGGAAGGTGAGGG + Intronic
951555139 3:23913868-23913890 CAGTGTTGAAAGGAACCTAAAGG - Intronic
953469686 3:43156001-43156023 CAGAGCTGGAAGGAACCGGAGGG + Intergenic
953509046 3:43516861-43516883 CAGAGTAGGAAGGAAGCACAGGG + Intronic
954489855 3:50893187-50893209 CAAAGCTGCAAGGAAGATGAAGG + Intronic
954876550 3:53806270-53806292 CAGACTTGACAGGAAGATGAGGG - Intronic
955531103 3:59873947-59873969 AAGTGTTGCTTGGAAGCTGAAGG - Intronic
955799187 3:62668535-62668557 CAGAGTTGCTGCAAAGCTGAAGG - Intronic
958745454 3:98128542-98128564 CAGAAGAGCAAGGAAACTGAAGG + Intergenic
958748263 3:98163880-98163902 CAGAAGGGCAAGGAAACTGAAGG + Intergenic
958752048 3:98203221-98203243 CAGAAGAGCAAGGAAACTGAAGG + Intergenic
959930183 3:111972088-111972110 CAGTGTTTCAAGCAAGCAGAAGG - Intronic
960635813 3:119783114-119783136 CAGAGTTGAAAGGATGCTAAGGG + Intronic
960635837 3:119783360-119783382 CAGAGTTGAAAGGATGTTGTAGG - Intronic
960801194 3:121542170-121542192 AAAAGTTGCAAGGAATCTTATGG + Intronic
961094050 3:124139673-124139695 AAGGGTTGCAAGGAAGGAGAGGG + Intronic
961143162 3:124572615-124572637 CAGAGTTGCTGGGAGGCTCAAGG + Intronic
961433087 3:126897047-126897069 GAGAGTTGGATGGGAGCTGAAGG + Intronic
962414459 3:135169346-135169368 CAGACTTCCAAGGAAGCCAAGGG - Intronic
962891220 3:139674770-139674792 CACAGTGGTAAGGAAACTGAAGG - Intronic
964624888 3:158749326-158749348 CAGAGTTGAAAGGAATCTTGGGG + Intronic
966690826 3:182739882-182739904 GAGAGATGCTTGGAAGCTGAAGG - Intergenic
966993016 3:185253610-185253632 CAAAGTTGCAAGTAAGCAGGAGG + Intronic
967649795 3:191972929-191972951 CAGAGTTGCCAGGAACCACAGGG + Intergenic
970403839 4:15743523-15743545 CAGAATGTTAAGGAAGCTGAGGG + Intergenic
970585918 4:17514131-17514153 GAGAGTGTCAAGGAAGCAGAGGG - Intergenic
971493378 4:27237896-27237918 CAGAGTCCCAAGGCAGCTCAGGG + Intergenic
971781653 4:31042939-31042961 CAGAGTCCCAAGGAAGCACAGGG + Intronic
972620134 4:40739719-40739741 GAAAGTTTCAAGGAAACTGAAGG - Intergenic
975497407 4:75049744-75049766 CACACTTGCAAGCAAGATGAAGG - Exonic
975521594 4:75307447-75307469 CCCAGTTGCACTGAAGCTGAGGG - Intergenic
975681060 4:76876568-76876590 CAAAGTTGAAAAGAAGCAGAGGG + Intergenic
978914103 4:114102606-114102628 GAGAATTGCAAAGAAGCTGGAGG - Intergenic
979636912 4:122966210-122966232 CAGAGTGGGAAAGAATCTGAAGG + Intronic
980953172 4:139401599-139401621 AAGAATTGAGAGGAAGCTGATGG + Intronic
981211023 4:142105173-142105195 TACAGTTGCAAGGAAGATGGGGG + Intronic
982467044 4:155744458-155744480 CAGAGTCCCAAGAAAGCTGGTGG + Intergenic
982821139 4:159941250-159941272 CAGAGTATCAAGCAAGCTCAGGG + Intergenic
985051877 4:185999290-185999312 CAGAGATGGAAGAAAGCAGATGG - Intergenic
985676528 5:1234370-1234392 GAGAGGTGCCAGGAGGCTGATGG - Intronic
986533977 5:8767373-8767395 CTGAATTGCAAGGAAGCTCTGGG + Intergenic
986802329 5:11275013-11275035 TAGAGTTGGTAGGAAGCTGGAGG + Intronic
987475068 5:18381415-18381437 CAGAGTGGCAAGCAGCCTGATGG - Intergenic
989208578 5:38835933-38835955 CTGAGTTGCAGGGAAACTGGAGG - Intergenic
990240323 5:53810586-53810608 CTGAGAACCAAGGAAGCTGATGG + Intergenic
990270772 5:54136017-54136039 CAGAGTTTCAAGACAGCAGAAGG + Intronic
994747276 5:103693843-103693865 CACAGGTGCAAGGAAGAAGAGGG - Intergenic
995446812 5:112254032-112254054 CAGAGTTGCCAGGAACCTTTTGG + Intronic
996434710 5:123422060-123422082 CAGATTTGCAAGAAAGTGGAGGG - Intronic
996895026 5:128470567-128470589 CAGAATGGCAAGGAAGCTCAGGG + Intronic
998425383 5:142022280-142022302 CACAGTGGCACGGAGGCTGAGGG + Intergenic
999614984 5:153413753-153413775 ATGAGTTGTATGGAAGCTGACGG - Intergenic
999823732 5:155254326-155254348 TAGAGTCGAAAGGAGGCTGAGGG - Intergenic
1000487923 5:161871290-161871312 CAAAGTTCCAAGGATGCTGAAGG - Intronic
1001440760 5:171741055-171741077 CAGAGTTCCAAGACAGCTCAGGG + Intergenic
1002878816 6:1234472-1234494 CAGAGGTGCAAAGAAGCCCAAGG - Intergenic
1003529790 6:6928051-6928073 CAGAGTGGCAGAGACGCTGAGGG + Intergenic
1003891052 6:10564101-10564123 CAGAGGTGCAGGAAAGATGAAGG + Intronic
1005277356 6:24234076-24234098 CAGACTTGTAAGGAAGCAGGAGG + Intronic
1006140101 6:31923373-31923395 CACAGATGGAAGGAAGCTGGAGG + Intronic
1006572061 6:35013753-35013775 CAGAGTTATAAGGATGGTGAAGG + Intronic
1007130590 6:39469788-39469810 CAGAGTTCCAAGAAAGATAAAGG + Intronic
1007685447 6:43664836-43664858 CAGACTTGTCAGGAGGCTGAGGG + Intronic
1007849697 6:44791417-44791439 AAGAATTGAAAGGAAGCTTAGGG + Intergenic
1008645653 6:53511771-53511793 CAATGTTGCTAGGAAACTGATGG + Intronic
1013598753 6:111684668-111684690 CACCGTTGCAAGGAGGGTGATGG - Intronic
1013953693 6:115816426-115816448 CAGAGAACCAAGGAAGCTAATGG + Intergenic
1016466959 6:144335364-144335386 CAGAGTTGCAAAGGAGCGGGTGG - Intronic
1019140888 6:169941440-169941462 CAGAGAGGCAGAGAAGCTGACGG + Intergenic
1020431159 7:8117465-8117487 CAGAGGTGCAAAGAAGCTTATGG - Intronic
1023115857 7:36861847-36861869 CGGAGCTGCAATGAGGCTGATGG + Intronic
1023486629 7:40694416-40694438 CTGAGATGCAAAGAAGCTAAGGG - Intronic
1023622853 7:42090557-42090579 CAGCTTTGCAAGTAATCTGAAGG + Intronic
1023625480 7:42111345-42111367 CCAAGTTGCAAGGTAGCTCAAGG + Intronic
1023813070 7:43926988-43927010 CAGGGTAGCGGGGAAGCTGAAGG + Intronic
1024557439 7:50615561-50615583 CAGAGGTGAAAGGGAGCTGGCGG - Intronic
1028634433 7:92971370-92971392 AGGAGGTGCAAGGAGGCTGAGGG - Intergenic
1030801221 7:113855539-113855561 CATAGTTGCAAACAAGCTCATGG - Intergenic
1031305831 7:120125803-120125825 CAGAAGAGCAAGGGAGCTGAAGG - Intergenic
1034685847 7:152970694-152970716 CAAAGTTGCAAGAAAGCAGTGGG - Intergenic
1036242704 8:7092844-7092866 CAGAGTTGAGAGGAGGCAGATGG + Intergenic
1036693812 8:10961641-10961663 CAGTGTTGCCAGGAAGCTGGAGG - Intronic
1036899111 8:12658594-12658616 CAGAGTTGAGAGGAGGCAGATGG - Intergenic
1037328307 8:17717304-17717326 CAAAGTTGACAGGAAGCTAATGG + Intronic
1037954496 8:23043346-23043368 GAGAGCTGCAAGAAAGATGAGGG - Intronic
1038264056 8:26023361-26023383 CAGATTTGCTAGGAAGTGGATGG - Intronic
1038328134 8:26587842-26587864 CAGAGTTTCTAGGAAGCAGCTGG + Intronic
1038369144 8:26970218-26970240 CAGATTTGAAGGGAAGATGATGG + Intergenic
1042929612 8:74000337-74000359 CACAGTTGCAAAGAACTTGATGG - Intronic
1043122561 8:76346550-76346572 GAAAGATGCAAGGAAACTGAGGG + Intergenic
1043185372 8:77141458-77141480 CAGATTTACAAAGAAGCTAAAGG - Intergenic
1044590272 8:93907569-93907591 CAGAGTTGGAGGGACTCTGATGG + Intronic
1045746659 8:105430757-105430779 CTGAGTTAGAAGGAGGCTGATGG + Intronic
1046507076 8:115150110-115150132 TATAGTTGCATGGGAGCTGATGG - Intergenic
1049195329 8:141312678-141312700 CAGAGGGCCAGGGAAGCTGAGGG - Intergenic
1050161584 9:2725107-2725129 GAGAAATGCAGGGAAGCTGAGGG + Intronic
1051286163 9:15499042-15499064 CAGAGCTGAAAGGAAACTGAGGG + Intronic
1053225591 9:36353210-36353232 AAGAACTGCAAGGGAGCTGATGG + Exonic
1055023530 9:71695166-71695188 CAGAGTGGCAAGGAAGAGGGTGG - Intronic
1055183972 9:73427682-73427704 CAAAGTAGCAAGGGAGCTAATGG + Intergenic
1055427230 9:76208594-76208616 CAGAGGTTCAAGGGAGATGATGG - Intronic
1055473981 9:76643231-76643253 CTGTGTTGAAAGGAAGCTCATGG - Intronic
1056165267 9:83935050-83935072 CAGAGTTGCAAGGAAAAGGAAGG + Intergenic
1056822709 9:89854749-89854771 CAGAGCTGGTAGGAAGTTGAAGG - Intergenic
1059976222 9:119720206-119720228 CAGAGGTCCCAGGAAGCAGAAGG + Intergenic
1061040254 9:128137535-128137557 CAGAGCTGGTAGGAAGTTGAAGG + Intergenic
1061946050 9:133908601-133908623 CAGACTTCCAAGGAAGCTCTGGG - Intronic
1061997303 9:134193029-134193051 CAGAGCTGCAGCGAAGCTGCGGG + Intergenic
1062373132 9:136250418-136250440 CAGATTTGCAGCGAATCTGATGG - Intergenic
1203616087 Un_KI270749v1:66278-66300 CAGAGATGCAAGGATACTAATGG + Intergenic
1186293331 X:8122403-8122425 CAGCGTGGAAAGGGAGCTGAGGG - Intergenic
1189650092 X:43179384-43179406 CAGAGATGCAGGGATGGTGATGG - Intergenic
1190797595 X:53759500-53759522 CAGAGTTGTGAGAAAGATGAGGG - Intergenic
1191638285 X:63401732-63401754 CAGAGTTTCAAGGCAGCACAGGG + Intergenic
1192348675 X:70335894-70335916 CAGAGTTGCAGGGATGGAGAGGG - Intronic
1192468433 X:71375092-71375114 TTGAGTGGCAAGGAAGCTTAAGG + Intronic
1193888931 X:87018256-87018278 CACCATTGCAGGGAAGCTGATGG - Intergenic
1194555998 X:95360625-95360647 CACAGTAGAAAGAAAGCTGAGGG - Intergenic
1195158408 X:102145433-102145455 CAGAGTTCTGAGAAAGCTGATGG + Intergenic
1195751250 X:108163393-108163415 CACAGTGCCAAGGAGGCTGAGGG + Intronic
1195866476 X:109438289-109438311 CAGAATAGCAAGCTAGCTGAAGG + Intronic
1197100778 X:122651963-122651985 CTCAGTGGCAAGGGAGCTGATGG - Intergenic
1198637543 X:138715898-138715920 AGGAGCTGTAAGGAAGCTGAGGG + Intronic
1200257502 X:154592066-154592088 CTGAGCTGCAGGGAACCTGAAGG + Intergenic