ID: 1080900377

View in Genome Browser
Species Human (GRCh38)
Location 11:36484169-36484191
Sequence CCGTGCATGCTGATGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080900373_1080900377 7 Left 1080900373 11:36484139-36484161 CCATTAGGAGCAGGGCTTGTTTT No data
Right 1080900377 11:36484169-36484191 CCGTGCATGCTGATGGTGCAGGG No data
1080900368_1080900377 25 Left 1080900368 11:36484121-36484143 CCATCCGAGGTTTCACTGCCATT No data
Right 1080900377 11:36484169-36484191 CCGTGCATGCTGATGGTGCAGGG No data
1080900370_1080900377 21 Left 1080900370 11:36484125-36484147 CCGAGGTTTCACTGCCATTAGGA No data
Right 1080900377 11:36484169-36484191 CCGTGCATGCTGATGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080900377 Original CRISPR CCGTGCATGCTGATGGTGCA GGG Intergenic
No off target data available for this crispr