ID: 1080902494

View in Genome Browser
Species Human (GRCh38)
Location 11:36509729-36509751
Sequence CCCCGACCTGTGGGAAGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080902486_1080902494 13 Left 1080902486 11:36509693-36509715 CCTGGGGAGCAGAGGTCAGGGGA 0: 1
1: 0
2: 6
3: 76
4: 563
Right 1080902494 11:36509729-36509751 CCCCGACCTGTGGGAAGCGTGGG 0: 1
1: 0
2: 0
3: 8
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080902494 Original CRISPR CCCCGACCTGTGGGAAGCGT GGG Intronic
900508339 1:3042245-3042267 CCCAGAACTTTGGGAAGCCTAGG - Intergenic
901103363 1:6736526-6736548 CCCAGACCTTTGGGAAGTGGAGG - Intergenic
901207658 1:7506048-7506070 CCCAGACCAGAGGGAAGCGGAGG + Intronic
901741133 1:11342750-11342772 GCCCCACCTGTGGGGAGAGTAGG - Intergenic
902154860 1:14477096-14477118 CCACGACATGTGGGAATTGTGGG - Intergenic
902333336 1:15741575-15741597 CCCCGGCCTGTGGGAGGAGAAGG + Intergenic
902617449 1:17631491-17631513 CCCCAACCTGTTGAAAGCCTTGG - Intronic
902913809 1:19623169-19623191 CCCCGCACTCTGGGAGGCGTAGG - Intronic
904530227 1:31163747-31163769 CCCAGAACTTTGGGAAGCCTAGG + Intergenic
904533028 1:31181706-31181728 CCCCGACCTGCGGGAAACAAAGG + Exonic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
906765463 1:48427176-48427198 CCCAGCACTTTGGGAAGCGTAGG - Intronic
909251544 1:73363366-73363388 CCCAGACCTTTGGGAAGCCAAGG + Intergenic
913396247 1:118375733-118375755 CCCTGACATGTGGGAAGTGTGGG + Intergenic
915565370 1:156709991-156710013 CCCAGCCCTGAGGAAAGCGTTGG - Intergenic
916107087 1:161440535-161440557 CTGCGCCCGGTGGGAAGCGTAGG - Intergenic
919460592 1:197872227-197872249 CCCCAACCTGTGTGTAGCCTAGG - Intergenic
919797197 1:201328039-201328061 CACCGACCTGTGGGAACAGGAGG - Intronic
921495969 1:215842071-215842093 CCCAGCACTGTGGGAAGCTTAGG + Intronic
921703626 1:218294734-218294756 CCCCAACCTCTGGGAAGGGAGGG - Intronic
922521806 1:226259208-226259230 CCCAGCCCTTTGGGAAGCTTAGG - Intronic
923678596 1:236100991-236101013 CCCAGGGCTGTGGGAAGCGCGGG - Intergenic
923762359 1:236858397-236858419 CCACGACGTGTGGGAATTGTGGG + Intronic
1063544219 10:6964209-6964231 CCACGACATGTGGGAACTGTGGG - Intergenic
1064031504 10:11885987-11886009 CCCCGAACTGTGGGAGGCCTGGG + Intergenic
1070781153 10:79138103-79138125 CTCCAACCTGTGGGCAGAGTGGG + Intronic
1073042833 10:100618946-100618968 CCCCATCCTGTGGGAACCCTTGG + Intergenic
1073259594 10:102179034-102179056 CCCAGAACTCTGGGAAGCCTAGG - Intergenic
1075127700 10:119713771-119713793 TTCCAACCTGTGGGAAGGGTTGG - Intergenic
1076223362 10:128753467-128753489 CCCTGACCTGTGGGAACCACTGG - Intergenic
1076917784 10:133433104-133433126 CCCCGCCCTGGGTGCAGCGTGGG + Intergenic
1076937778 10:133577179-133577201 CCCCGCCCTGGGTGCAGCGTGGG + Intergenic
1077884765 11:6378851-6378873 CCCCGCCCTGTGGAAGACGTAGG - Intergenic
1080902494 11:36509729-36509751 CCCCGACCTGTGGGAAGCGTGGG + Intronic
1080902502 11:36509765-36509787 TCCCGACCTGCAGGAAGCGAGGG + Intronic
1080902533 11:36509876-36509898 CCCTGACCTGTGAAAAGCGAAGG + Intronic
1080902546 11:36509913-36509935 CCCCGACTGGTGGGAAGCGAGGG + Intronic
1081083870 11:38775212-38775234 CCCCGTGCTGTGTGAAGCCTAGG - Intergenic
1081578965 11:44339059-44339081 CCCCGGCCTCTGGGAAGCCGGGG - Intergenic
1081891770 11:46548740-46548762 CCCCGAACTTTGGGAAGCCAAGG + Intronic
1083174109 11:60938686-60938708 CCCAAGCCTTTGGGAAGCGTGGG - Intronic
1085551451 11:77377026-77377048 CCCAGAACTGTGGGAAGCCAAGG + Intronic
1086191152 11:84080739-84080761 CCCAGACCTTTGGGAAGCTGAGG + Intronic
1086580242 11:88391078-88391100 CCACTACATGTGGGAAGTGTGGG + Intergenic
1087725724 11:101713989-101714011 CTCCCACATGTGGGAAGTGTGGG + Intronic
1087833679 11:102847700-102847722 CCACGACATGTGGGAATTGTTGG - Intergenic
1089133873 11:116233976-116233998 CCTCGTCCTGTAGGAAGCTTGGG - Intergenic
1090299920 11:125626288-125626310 CCCCGGCCTTTGGGACGGGTGGG + Intronic
1092040345 12:5378711-5378733 TCCCTACCTGGGGGAAGAGTGGG + Intergenic
1094349624 12:29509457-29509479 CCCAAACCTGGGGGAAGCTTAGG - Intronic
1096063470 12:48721261-48721283 CCACGACATGTGGGAATTGTGGG + Intergenic
1100348178 12:93753053-93753075 CCACGACATGTGGGAATTGTGGG + Intronic
1102902719 12:116650898-116650920 CCACGACATGTGGGAATTGTCGG - Intergenic
1103558527 12:121779957-121779979 CCCAGGCCTGTGAGAAGAGTTGG + Exonic
1104402354 12:128486527-128486549 CCCTGCCCTGTGGAAAGTGTGGG + Intronic
1105889867 13:24674903-24674925 CCCCCAGCTCTGGAAAGCGTGGG + Intergenic
1108103682 13:46985521-46985543 CCACTTCCTGTGGGAAACGTGGG + Intergenic
1109496380 13:63177901-63177923 CCCCGAGCTGTGTGCAGCCTAGG + Intergenic
1113176757 13:107573663-107573685 CCATGACATGTGGGAATCGTGGG - Intronic
1114936986 14:27550633-27550655 CCTGGACCAGTGGGAAGCCTGGG + Intergenic
1119064727 14:71513737-71513759 CCCTGTCCTTTGGGAAGCCTAGG - Intronic
1119562101 14:75598724-75598746 CCCAGCCCTGTGGGAGGCGGAGG - Intronic
1119942121 14:78651838-78651860 CCACGACATGTGGGAATTGTGGG + Intronic
1120026419 14:79590150-79590172 CCACGACATGTGGGAATTGTGGG - Intronic
1120794636 14:88619113-88619135 CCCAGAACTTTGGGAAGCGGAGG + Exonic
1120876432 14:89380103-89380125 CCCCGACATGTGGGAATTATGGG - Intronic
1121721109 14:96109255-96109277 CCAAAACCTGTGGGAAGTGTTGG - Intergenic
1122246086 14:100404527-100404549 CCCCTACCTGTGGGCTGCGTGGG + Intronic
1123034367 14:105465951-105465973 CCCTGTCCTGTGGGAAGAGGTGG + Intronic
1124109123 15:26771667-26771689 TTCTGACCTGTGGGAAGCGGAGG - Intronic
1124695859 15:31863623-31863645 CCCCGAGCTGTGTGCAGCCTAGG - Intronic
1126858967 15:52865572-52865594 CCACGACATGTGGGAATTGTGGG + Intergenic
1127949876 15:63794444-63794466 CCCCAACCTCTGGGAAGGGGAGG - Intronic
1130075067 15:80681585-80681607 CCCAGAACTTTGGGAAGCGGAGG - Intronic
1130086324 15:80780588-80780610 CTCTCACCTGTGGGTAGCGTTGG - Intronic
1134216471 16:12320467-12320489 CCCCAAGCTGTGGGAAGCAGAGG + Intronic
1138215897 16:55205071-55205093 ACCCTACCTGTGGGAAGACTGGG - Intergenic
1139114564 16:63933858-63933880 CCACGACATGTGGGAATTGTGGG + Intergenic
1140244523 16:73235919-73235941 CCCAGCCCTTTGGGAAGCCTAGG - Intergenic
1142118071 16:88370739-88370761 GGCCGAGCTGTGGGAAGGGTGGG + Intergenic
1142217286 16:88836000-88836022 CCTCGCCCCGTGGGACGCGTGGG - Intronic
1142217300 16:88836040-88836062 CCTCGCCCCGTGGGACGCGTGGG - Intronic
1142217321 16:88836119-88836141 CCTCATCCTGTGGGAGGCGTGGG - Intronic
1142217335 16:88836159-88836181 CCTCGCCCTGTGGGACGCATGGG - Intronic
1144312933 17:14030201-14030223 CCACGACATGTGGGAATTGTGGG - Intergenic
1144331817 17:14231126-14231148 CCACGACATGTGGGAATTGTGGG + Intergenic
1146276978 17:31522435-31522457 CCCCGGCCAGTGGGCAGCATGGG - Intronic
1147609549 17:41793515-41793537 CCCTGACCTGTGGAGAGCCTTGG + Intergenic
1148505377 17:48122943-48122965 CCCAGAACTGTGAGAAGAGTTGG - Exonic
1150221829 17:63499985-63500007 CCACCACCTGTGGCTAGCGTAGG - Intronic
1152195509 17:78916056-78916078 CCCCGCCCTGAGGGAGGCCTGGG - Intronic
1152408866 17:80112085-80112107 CCCTCACCTGTGGGAGGCGATGG - Intergenic
1152757361 17:82092583-82092605 CGCCCACCTGTGGGAAACATGGG + Exonic
1156673463 18:39498931-39498953 CCATGACATGTGGGAATCGTGGG + Intergenic
1157045668 18:44099589-44099611 CCACGACATGTGGGAATTGTGGG - Intergenic
1159045915 18:63368026-63368048 CCCCGACCTTTGGGAGGCTGAGG + Intergenic
1161364194 19:3868820-3868842 CCCCGGCCTGAGGGAAGCCGCGG - Intronic
1163826644 19:19527991-19528013 CCCCCACCTGTGGGGACAGTGGG - Exonic
1164500045 19:28811406-28811428 CCCAGAACTTTGGGAAGCGGAGG + Intergenic
926570285 2:14522135-14522157 CCCCGACATGTGGGAATTATGGG - Intergenic
926744548 2:16139907-16139929 ACCAGAGCTGAGGGAAGCGTCGG - Intergenic
927074670 2:19565867-19565889 CCATGACCTGTGGGAACTGTGGG - Intergenic
929184677 2:39081267-39081289 CCCAGCACTGTGAGAAGCGTGGG + Intronic
930310548 2:49733741-49733763 CCACGACATGTGGGAATTGTGGG + Intergenic
933788158 2:85860620-85860642 CCCCGACCTTTGGGAGGCCAAGG + Intronic
935695688 2:105768965-105768987 CCCCAACCTCTGGGAGGGGTGGG - Intronic
936486920 2:112933585-112933607 CCCCGATCTGTGAAAAGCGGTGG - Intergenic
937879796 2:126856831-126856853 CCCCATTCTGTGGGAAGGGTTGG - Intergenic
938537151 2:132256490-132256512 CCCCGACGTTTGGGCAGCGAAGG + Intronic
940328727 2:152452631-152452653 CCCCCATCTGTGGGAAGTGAGGG + Intronic
941181638 2:162266307-162266329 CCCCAGCCAGTGGGAATCGTGGG - Intergenic
942276407 2:174326836-174326858 CGCCGACCTGGGGGAGGCGGAGG - Intergenic
943911949 2:193580345-193580367 CCCGGAACTTTGGGAAGCCTAGG + Intergenic
944577710 2:201105578-201105600 CCCAGAACTTTGGGAAGCCTAGG + Intergenic
946844726 2:223849194-223849216 CCACAACATGTGGGAATCGTGGG + Intergenic
947111150 2:226721076-226721098 CCCCCACCTCTGGGATGCGCTGG - Intergenic
947982000 2:234418562-234418584 CCCAGACTTGTGGGAAGGGGAGG - Intergenic
1169131506 20:3168324-3168346 CTCCCACCTGTGGGAAACGCAGG - Intronic
1171810922 20:29743716-29743738 CCCCGTCCAGGGGGAAGCGGAGG + Intergenic
1171908569 20:30921265-30921287 CCCCGCACTTTGGGAAGCGAGGG - Intergenic
1172843613 20:37916386-37916408 CCCAGACATGTGGGAAGAGGAGG + Intronic
1173495868 20:43517045-43517067 CCCAGAACTTTGGGAAGCCTAGG - Intronic
1178459362 21:32788259-32788281 CCACAACCTGTGGGAATTGTGGG + Intergenic
1179222192 21:39418178-39418200 CCCTGACATGTGGGAACTGTGGG + Intronic
1179621209 21:42617520-42617542 CACCGACCTGTGGAAGGGGTGGG - Intergenic
1181534615 22:23534962-23534984 CCCGGGCATGTGGGAAGCGAGGG + Intergenic
1181965779 22:26655932-26655954 CCCAGAACTTTGGGAAGCCTGGG - Intergenic
1183688343 22:39374749-39374771 CCCCTGCCTGTGGGCAGCATGGG - Intronic
1185035583 22:48475047-48475069 CCCCGGCCTGTGGGAGGCAGAGG - Intergenic
952946325 3:38479862-38479884 CCTGGAGCTGTGGGAAGGGTTGG + Intronic
953409144 3:42679464-42679486 CCACGACACGTGGGAATCGTGGG + Intergenic
953561333 3:43995665-43995687 CCCCGAGCTGAGGGCAGGGTAGG + Intergenic
954224539 3:49173528-49173550 CCCTGGCGTGTGGGAAGGGTTGG - Intronic
959525498 3:107372083-107372105 CCCAGATCTGTTGGAAGCATTGG + Intergenic
969421906 4:7102381-7102403 CCCAGAGCTGTGGGAAGGGAGGG + Intergenic
969441203 4:7217805-7217827 CTCCGACCTGTGGGAGCCGTGGG + Intronic
975942109 4:79660337-79660359 CCCCGTGCTGTGTGAAGCCTAGG + Intergenic
977827570 4:101551834-101551856 CACAGAACTGTGGGCAGCGTGGG - Intronic
981297835 4:143153647-143153669 CCACGACATGTGGGAATTGTGGG - Intergenic
982060771 4:151602096-151602118 CCACGACATGTGGGAATTGTGGG + Intronic
985230502 4:187810930-187810952 CCCAGCCCTTTGGGAAGCTTAGG + Intergenic
985803297 5:2020230-2020252 CCACGACATGTGGGAATCATGGG - Intergenic
988191216 5:27937715-27937737 CCCCGAAGTTTGGGAAGGGTTGG - Intergenic
989188288 5:38645571-38645593 GCCCTTCCTGTGGGAAGCTTGGG + Intergenic
990788835 5:59454281-59454303 CCACGACATGTGGGAATTGTGGG - Intronic
991607724 5:68420196-68420218 CCCCCACCTATGGGGAGCTTGGG + Intergenic
995912748 5:117207469-117207491 CCACGACATGTGGGAATTGTGGG - Intergenic
996247515 5:121282802-121282824 CCCTGAGCTGTGTGAAGCCTAGG + Intergenic
996328493 5:122304108-122304130 CCCAGAACTTTGGGAAGCGGAGG + Intergenic
998278028 5:140776995-140777017 CCCAGAACTGTGGGAAGCAGAGG + Intergenic
1002785125 6:394088-394110 CCCCCACCTGTGGGCAGAGCAGG + Intronic
1006670248 6:35725894-35725916 CCCCGAGCTGTGGGAGAAGTGGG - Intronic
1009316119 6:62223349-62223371 CCCCAACCTGTGTGCAGCCTAGG - Intronic
1009460634 6:63908699-63908721 CCCAGCACTGTGGGAGGCGTAGG - Intronic
1010076833 6:71808510-71808532 CCTCGACATGTGGGAATTGTGGG + Intergenic
1013302473 6:108817591-108817613 CCACGACATGTGGGAATTGTGGG + Intergenic
1016437473 6:144051882-144051904 CCACGACATGTGGGAATTGTGGG + Intronic
1018710467 6:166495010-166495032 CACGGACGTGTGGGAAGCGTGGG + Intronic
1019656090 7:2196881-2196903 CCCCGAAGTGTGGGGAGGGTGGG - Intronic
1019971133 7:4541786-4541808 CCACGACATGTGGGAATTGTGGG - Intergenic
1020288721 7:6706458-6706480 CCCCGGCCTGTCGGGAGCGGTGG - Exonic
1020394030 7:7692855-7692877 CCCAGCCCTGTGGGAAGCCGAGG - Intronic
1026682844 7:72481337-72481359 CCCAGCCCTTTGGGAAGCCTAGG - Intergenic
1026843693 7:73685054-73685076 CCCAGCCCTGTGGGAGGCGGAGG + Intronic
1028421010 7:90632836-90632858 CCCAGACCTTTGGGAAGCCGAGG + Intronic
1030437255 7:109538742-109538764 CCTGGACCTGTGGGAAGAATAGG - Intergenic
1032309635 7:130772493-130772515 CCACGACATGTGGGAATTGTGGG - Intergenic
1033998622 7:147385186-147385208 CCCTGACTCGTGGGAAGTGTGGG + Intronic
1034137151 7:148781329-148781351 CCCAGAACTTTGGGAGGCGTAGG - Intronic
1035435558 7:158856717-158856739 CCCGGGCCTGCGGGAAGCGATGG + Exonic
1036407609 8:8468957-8468979 CCCCAAGCTGTGGGAAGCTGGGG + Intergenic
1036733526 8:11286200-11286222 CCCAGAACTGTGGGAGGCCTAGG - Intronic
1037155617 8:15695211-15695233 CCATGACATGTGGGAACCGTGGG - Intronic
1039797493 8:40927599-40927621 CCACGACATGTGGGAATTGTGGG + Intergenic
1040435152 8:47383054-47383076 CCCCGAACTGTTGGAAGCCCAGG + Intronic
1040717455 8:50274335-50274357 CCCAGCACTTTGGGAAGCGTAGG - Intronic
1041115467 8:54531552-54531574 CCACGACATGTGGGAATTGTGGG - Intergenic
1042837450 8:73091437-73091459 CCCTGATCTGTGGTAAGCGCAGG - Intronic
1043293054 8:78628093-78628115 CCCAGACCTTTGGGAAGCCGAGG + Intergenic
1044193453 8:89346672-89346694 CCCTGACATGTGGGAATTGTGGG + Intergenic
1044364851 8:91332780-91332802 CCCAGAACTGTGGGAAGCTGAGG - Intronic
1045940708 8:107735098-107735120 CCCGGACATGTGGGAATTGTGGG + Intergenic
1046720501 8:117613430-117613452 CCACGACATGTGGGAATTGTGGG + Intergenic
1049490435 8:142897232-142897254 CCCAGAACTGTGGGAGGCTTAGG - Intronic
1049603769 8:143519863-143519885 CCCTGCCCTGTGGGAAGCCACGG + Intronic
1057996210 9:99823320-99823342 CTCCAACCTGTTGGAAGCCTCGG + Intronic
1060775121 9:126367397-126367419 CCGGCACATGTGGGAAGCGTGGG - Intronic
1061162002 9:128900922-128900944 CCCCGCACTGTGGGAAGCTGAGG + Intronic
1061235039 9:129337221-129337243 CCCGGTCCTCTGGGAAGCGTGGG + Intergenic
1062572947 9:137193984-137194006 CCCCCAGCTGTGGGAGGCGGGGG - Intronic
1185844994 X:3429718-3429740 CCACGACATGTGGGAATTGTAGG - Intergenic
1188535418 X:31191453-31191475 CCACGACATGTGGGAATTGTGGG - Intronic
1197273368 X:124450030-124450052 CCACGACCTGTGGGAATTGTAGG - Intronic