ID: 1080913288

View in Genome Browser
Species Human (GRCh38)
Location 11:36627436-36627458
Sequence GAGCCAAACCCAGGATCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080913288_1080913291 -10 Left 1080913288 11:36627436-36627458 CCTTGTGATCCTGGGTTTGGCTC 0: 1
1: 0
2: 3
3: 12
4: 229
Right 1080913291 11:36627449-36627471 GGTTTGGCTCAAGAACTAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080913288 Original CRISPR GAGCCAAACCCAGGATCACA AGG (reversed) Intronic
900478989 1:2889305-2889327 GAGCCACCCCCAGGCTCCCAGGG + Intergenic
901971618 1:12913178-12913200 AAGTCAAACCAAGGCTCACATGG - Intronic
902013549 1:13288562-13288584 AAGTCAAACCAAGGCTCACATGG + Intergenic
902796931 1:18806211-18806233 GAGCCAAAGCCAGGAGCCCCTGG + Intergenic
903192942 1:21667009-21667031 GACCCAGACACAGGAACACACGG - Intronic
906265495 1:44425625-44425647 GAGACTTACCCAGCATCACACGG - Intronic
906415950 1:45621629-45621651 GGGCCTCACCCAGGATCATAGGG + Exonic
911934720 1:103954617-103954639 TAGCCAAACCCAAGATCATCTGG + Intergenic
912673049 1:111649231-111649253 GAGCAAAATCCAGGAGCACCTGG - Intronic
912980011 1:114362893-114362915 GATCCAAACCCAGGTTGTCATGG - Intergenic
913655756 1:120957979-120958001 GAACCAAACCCAGGTTGTCATGG + Intergenic
915553944 1:156650986-156651008 GCCCCAAGCCCAAGATCACAAGG + Intronic
916389620 1:164317247-164317269 GAGCCAACCCCAGCATAAAAAGG + Intergenic
918877514 1:190067911-190067933 TGGCCAAACCCACAATCACATGG + Intergenic
919147507 1:193654714-193654736 GAGACAATCCCATCATCACAAGG - Intergenic
920315209 1:205071894-205071916 TAGTCAAGCCCAGGATCTCAGGG - Intronic
921049906 1:211503921-211503943 GACACAAACCTAGAATCACACGG - Intergenic
921256021 1:213340202-213340224 GAGAGAAGCCCAGCATCACAGGG - Intergenic
922131884 1:222788025-222788047 GAGTCAAACACTGGGTCACAGGG + Intergenic
923491587 1:234488887-234488909 AAGCCAGACCCAGGACCAGAAGG - Intergenic
923914945 1:238491680-238491702 GAGCAAAATCCCGGAGCACATGG + Intergenic
1062909039 10:1200173-1200195 GAGCCCCACCCAGGAGCCCAGGG + Intronic
1063162789 10:3431713-3431735 GTGCCATTCCCAGGAGCACAGGG - Intergenic
1063951190 10:11224905-11224927 GAGCCAAGGCCAGGATCAGAGGG + Intronic
1068218110 10:54009865-54009887 GAGCCATACTCAGGCACACAGGG + Intronic
1068222846 10:54064884-54064906 GAGCTACACCCAGGATGGCAGGG + Intronic
1069992076 10:72322181-72322203 GAGCCACACCCTGGAAGACAAGG - Intergenic
1071598719 10:86945720-86945742 GAGCCACACCCAGGTCAACAGGG + Intronic
1072070880 10:91916070-91916092 AAGCCAAGCCCAGGACCAGATGG - Intergenic
1075637807 10:124042240-124042262 GAGCCAGAGCCAGGACCCCAGGG + Intronic
1076414779 10:130277853-130277875 GTGACAAACCCACAATCACAGGG - Intergenic
1076935008 10:133562091-133562113 GAACCAAACCCAGGCTGTCATGG - Intronic
1077210853 11:1370393-1370415 GACCCACACCCAGGGTCCCAGGG + Intergenic
1077745537 11:4900258-4900280 TAGCCAAACCTAGTATCTCAGGG - Intronic
1078322674 11:10350846-10350868 GAGACAAACTGAGGCTCACAAGG + Intronic
1079241691 11:18726418-18726440 GAGCCAAAACCTGTACCACAAGG - Intergenic
1080363287 11:31542268-31542290 GAGACACAGCTAGGATCACAAGG + Intronic
1080711256 11:34750056-34750078 GAGTCAAACCCAGCTTCACTGGG + Intergenic
1080913288 11:36627436-36627458 GAGCCAAACCCAGGATCACAAGG - Intronic
1081127488 11:39339956-39339978 GAGCCAAGCACAAGCTCACACGG + Intergenic
1083383480 11:62288577-62288599 GAACCAAAGCCAGGTTCTCATGG + Intergenic
1083968006 11:66054710-66054732 GAGGCAAATCCTGGATCAGAAGG - Intronic
1084958884 11:72705902-72705924 GGGCCAGACCCAGAATCACCTGG + Intronic
1085336282 11:75699117-75699139 GAGCCAAGCCCTGGACCTCAGGG + Intergenic
1087796701 11:102461640-102461662 AAGCAAAACCAAGAATCACAAGG + Intronic
1088757486 11:112898136-112898158 CAGCCAAACCAAGGGTCATAAGG - Intergenic
1093585293 12:20828824-20828846 GAACCAAACCCAGGCTGTCATGG + Intronic
1094842510 12:34348009-34348031 GGCCCAAACCCAGGATCACAGGG + Intergenic
1096527420 12:52219493-52219515 ATACCAAACCCATGATCACATGG + Intergenic
1097012589 12:55964001-55964023 GAGCAAAACCCTGTATCAAAAGG - Intronic
1097391762 12:59023939-59023961 GAGCCAAACCCAGGGCCTCTTGG + Intergenic
1100328828 12:93567085-93567107 GAGTGCATCCCAGGATCACAGGG + Intergenic
1104529789 12:129558607-129558629 GACCGTAACCCAGGACCACACGG + Intronic
1106896875 13:34312738-34312760 AAGCCACACCCAGGATGACTGGG + Intergenic
1111645499 13:91027057-91027079 GAGCAGAACCAAGGATCACCAGG + Intergenic
1112727570 13:102322028-102322050 CACCCAAACCCTGGAACACAAGG + Intronic
1113237668 13:108298737-108298759 GAGGCCAAGGCAGGATCACAAGG + Intronic
1115361552 14:32509054-32509076 GAGGCCAAGGCAGGATCACAAGG - Intronic
1115653466 14:35420640-35420662 GAGCTAAACACTGGGTCACATGG + Intergenic
1118693221 14:68359975-68359997 GAGCCCAGCCCAGGCTGACAAGG - Intronic
1118966822 14:70594885-70594907 GAGCAAAATCCAGGAGCACCTGG + Intronic
1122480622 14:102044816-102044838 GAGCCACACCCAGCATAACCAGG - Intronic
1122738543 14:103857493-103857515 GAGCCACAGCCCGGACCACAGGG - Intergenic
1124019174 15:25903851-25903873 GAGCCAAAGGCAGGAGCCCATGG - Intergenic
1124396991 15:29310633-29310655 GGGCCAAGCCCAGGAGCACAAGG + Intronic
1126230636 15:46319391-46319413 GAGCCAAGCTCAGGCTCAGAAGG + Intergenic
1126665157 15:51069179-51069201 CAGCCAAAGGCAGGATCTCAGGG - Intronic
1127880348 15:63151821-63151843 GCTCCAAACCCAGCTTCACAAGG - Exonic
1129452368 15:75658244-75658266 GGTCCAAACCCAGGATCTCAGGG + Exonic
1129799131 15:78400349-78400371 GAAACTCACCCAGGATCACATGG - Intergenic
1130307873 15:82726896-82726918 GGGCCAAACACAGGATGACTGGG + Intergenic
1131312826 15:91306324-91306346 GAGGCAAAGCCAAGAGCACATGG - Intergenic
1132338287 15:101062781-101062803 GAGCCACACCTAGGACCACCTGG + Intronic
1137702684 16:50508179-50508201 AAGTCTCACCCAGGATCACACGG + Intergenic
1138573239 16:57889448-57889470 GACCCACTTCCAGGATCACATGG - Intronic
1138648727 16:58444720-58444742 GAGCCAGATCCAAGAGCACAGGG - Intergenic
1139512496 16:67435554-67435576 GAGACAACCCCAGAATCACCAGG - Intronic
1141240844 16:82263810-82263832 CTGCCAAGCCCAGGATCCCAGGG + Intergenic
1141382863 16:83591434-83591456 GAGTGAATCCCAGGAGCACATGG - Intronic
1141935663 16:87236367-87236389 GAGCCAGAGGCAGGACCACAGGG - Intronic
1143537680 17:7550866-7550888 GAGCCATACCCAGGAGGAGAGGG + Intronic
1147239459 17:39081005-39081027 CAGCCAGCCCCAGGATCCCAGGG + Intronic
1148187872 17:45657606-45657628 GAACCTCACCCAAGATCACATGG - Intergenic
1148819929 17:50354439-50354461 GAGCCAAGCCCAGCAGCCCATGG + Exonic
1149027409 17:52044172-52044194 AAGACAAACCCAGGAGCAGATGG - Intronic
1149936309 17:60810492-60810514 GAGCAAAACCCAGGAGCACCTGG + Intronic
1153928944 18:9861197-9861219 GAGATAAACCCAGGTTCTCAGGG - Exonic
1154238793 18:12632283-12632305 GAAGCAGACCCAGGAACACATGG - Intronic
1155240270 18:23857843-23857865 GATGCAAGCCCAGAATCACAGGG + Exonic
1155911215 18:31506168-31506190 GAATCAAACCCAGGTTCACCTGG + Intronic
1156290246 18:35742508-35742530 TTGCCAAACCCAAGGTCACAAGG + Intergenic
1157433528 18:47650371-47650393 GAGGCAAACCCTGGAGCACTGGG + Intergenic
1159280913 18:66284278-66284300 CACCCCAACCCAGGATCACCTGG + Intergenic
1159834257 18:73318274-73318296 GAGACAGACCCAGGCTTACATGG - Intergenic
1160141142 18:76324337-76324359 GCGCCAAGCCCAGGACCCCATGG + Intergenic
1163387274 19:17007598-17007620 GAGCCACAGGCAGGATCACGGGG - Intronic
1164496227 19:28765235-28765257 CAGCCAAACCCAAGAACAAAAGG + Intergenic
1168499030 19:56877959-56877981 GAGCCAACCCCAGCAACACCCGG - Intergenic
925035265 2:680204-680226 GAGCCACAGCCAGGCTGACATGG + Intergenic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925191447 2:1887632-1887654 GAGCCACACGGATGATCACATGG + Intronic
929233339 2:39581966-39581988 GAGCTAAAACCTGGATCTCATGG - Intergenic
929575442 2:43049114-43049136 AAGCCAAGTCCAGGATCAGAGGG - Intergenic
933049342 2:77583300-77583322 AAGCAATACCCAGGATCAGATGG + Intronic
933784210 2:85825751-85825773 GTGCCAAATCCAGGGTCATAAGG + Intergenic
937069864 2:119054830-119054852 GGGCAAAAGCAAGGATCACAAGG + Intergenic
938259188 2:129883124-129883146 GTTCCAAACCCAGGAGCACCTGG + Intergenic
939023173 2:136982223-136982245 GAGAGAAACCAAGGATCAGAAGG - Intronic
939919688 2:148094045-148094067 GAGACATGCCCATGATCACATGG + Intronic
941004558 2:160234735-160234757 GAGCCAAAATCAGGACCATACGG - Intronic
948424505 2:237878534-237878556 GGCCCAAACCCAGGCTCAGAGGG - Intronic
948901704 2:240959641-240959663 AAGCCAAGCCCAGGCTCTCAGGG + Intronic
1168938040 20:1685069-1685091 GAGCTGACCCCAGAATCACAGGG - Intergenic
1172031832 20:31987808-31987830 CAGGCTGACCCAGGATCACAGGG + Intronic
1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG + Intergenic
1173986129 20:47262941-47262963 AAGCCAAACCCAGTACCAGATGG + Intronic
1174828016 20:53786525-53786547 TAACCACACCTAGGATCACAAGG - Intergenic
1176623204 21:9072254-9072276 GAGGCAAACCCAGGGACAGAGGG - Intergenic
1179655984 21:42845011-42845033 GGGCCCAGCCCAGGGTCACACGG + Intronic
1180258395 21:46649804-46649826 GGGCCAACCTCAGGATCTCAAGG + Intronic
1181821318 22:25477857-25477879 GGGCCAAACCCAGGGTCAATAGG + Intergenic
1183036755 22:35146428-35146450 GACTCAAACCCAGAACCACATGG - Intergenic
1183829630 22:40410902-40410924 CTGCCAACCCCAGGATCCCAGGG - Exonic
950918834 3:16671982-16672004 GAACCAAACCCAGGCTGTCATGG - Intergenic
951070210 3:18319723-18319745 TTGCCAAATCCAAGATCACATGG + Intronic
951939040 3:28057395-28057417 TAGTTAAACCCAGAATCACACGG + Intergenic
953902934 3:46853496-46853518 GAACCAAACCCAGGAACATGTGG + Intergenic
954512212 3:51135559-51135581 GGGCCAAACCCAAGATCATCTGG - Intronic
954794513 3:53154762-53154784 GTACCAGGCCCAGGATCACAGGG - Intergenic
955179716 3:56656077-56656099 AAGCAAAACCAAGGATAACAGGG + Intronic
955753939 3:62209019-62209041 GCGCCAAAGCCAGCATCACATGG - Intronic
956700030 3:71950875-71950897 GAGGAAGACCCAGGATCTCAGGG + Intergenic
957237042 3:77607041-77607063 GAGCCATATCTAGGATTACATGG - Intronic
958580112 3:96007517-96007539 GAGGCAAACCCAGGATGAATTGG - Intergenic
958784747 3:98585675-98585697 GCGCCAAACCAGGGATCAAATGG + Intronic
959618648 3:108376216-108376238 GAACCAGGCCAAGGATCACAAGG + Intronic
962221298 3:133566548-133566570 GAGCAGATCCCAGAATCACATGG + Intergenic
964432323 3:156620498-156620520 GAGCCAAGCACAAGCTCACATGG - Intergenic
965105589 3:164348004-164348026 GATCCAAACCCAGGCTGCCATGG + Intergenic
965337588 3:167446449-167446471 GAGCCAGACTCATGATCACAGGG + Exonic
966612774 3:181884472-181884494 AAGCCTAACCCAGGAGCTCAGGG + Intergenic
966642251 3:182204086-182204108 GAGCCAGACCTGGGATCAGAGGG - Intergenic
967662499 3:192130343-192130365 GAGCCAAACCATGGATAAAAGGG + Intergenic
968057725 3:195705500-195705522 CAGCCACACCCAGGCCCACAGGG + Intergenic
968807028 4:2780736-2780758 GAACCAAACCCAGGCTGTCATGG + Intergenic
969166283 4:5318606-5318628 CAGCTAGACCCAGAATCACAGGG + Intronic
969908100 4:10416495-10416517 GAGCCAAAGCAAAGTTCACAAGG - Intergenic
971837811 4:31791413-31791435 GAGCCATTCCCAGGCTTACAGGG - Intergenic
972279717 4:37590394-37590416 CAGCCCCACCCAGGATGACAGGG + Exonic
975493758 4:75015739-75015761 GTGCCTCACCCAAGATCACATGG + Intronic
979050224 4:115921015-115921037 GAGCAAAATCCAGGAGCACCTGG + Intergenic
980024876 4:127753699-127753721 AAGAAAAACCCAGGATCAGATGG + Intronic
980368425 4:131837131-131837153 GAGCCAAAGCCAGGCTGCCATGG + Intergenic
981175727 4:141681006-141681028 GATACAAAGCCAGGATGACATGG - Intronic
981305444 4:143242154-143242176 GAGCCAAGCACAAGCTCACATGG - Intergenic
982727253 4:158918788-158918810 GAGACAAACCAAGGAGCAGAAGG + Intronic
983007418 4:162501035-162501057 AAGCCAAACCCAGGAAAACCAGG - Intergenic
984695671 4:182776929-182776951 GAGACAATGCCAAGATCACAAGG + Intronic
985823981 5:2179488-2179510 AAGCCAAAGCCAGGATCACAGGG + Intergenic
986103052 5:4631631-4631653 GTGCCAAACCCAGCAGCTCAGGG - Intergenic
986496177 5:8344214-8344236 GAGCCCATCCCAGCATAACATGG - Intergenic
988004917 5:25397180-25397202 GAGCCAGAGACAGGATCACATGG + Intergenic
990239211 5:53799860-53799882 GAGCCAACCACAGCACCACAAGG + Intergenic
992029772 5:72709437-72709459 CAGCCCTGCCCAGGATCACAGGG + Intergenic
992035043 5:72765052-72765074 AATTCAAACTCAGGATCACAGGG - Intergenic
994787738 5:104186317-104186339 GAGCCAAGCACAAGCTCACATGG - Intergenic
995524505 5:113039722-113039744 CAACCCACCCCAGGATCACATGG + Intronic
996893962 5:128456932-128456954 GAGCTAAACGAAGGATCAGATGG + Intronic
997698243 5:135878301-135878323 GAGCCAAGCCCAGACCCACAGGG + Intronic
998205039 5:140152055-140152077 GTGCCAGATCCAGGAGCACAGGG + Intergenic
1000149317 5:158484181-158484203 GATCCAATTCCTGGATCACATGG - Intergenic
1001428478 5:171641090-171641112 GAGACAGACCCAGGCTCAAATGG + Intergenic
1002063166 5:176638572-176638594 GAGCCAAGCCCAGAAGGACAAGG + Intronic
1002445783 5:179288962-179288984 GTGCCAAGCCCGGGATCTCAGGG + Intronic
1003485340 6:6571072-6571094 GAGCCGAGCCCAGGATACCAGGG - Intergenic
1005812076 6:29525074-29525096 GAACCAAACCCAGGCTGCCATGG + Intergenic
1006190460 6:32204427-32204449 GAGCCCAACCCAGCACTACAAGG + Intronic
1006254020 6:32814979-32815001 GAGCCATGGCCAGGTTCACATGG + Intronic
1007121952 6:39389619-39389641 GAGCCAAACTCAGGCTCAGCAGG - Intronic
1010022042 6:71171423-71171445 GAGTCAAAGCCAGGATGACGTGG - Intergenic
1011073033 6:83406448-83406470 GAAAAAAACCCAGGATCAGATGG - Intronic
1014178259 6:118353688-118353710 GAGCCAAGCACAAGCTCACATGG + Intergenic
1014195864 6:118557642-118557664 GAGCCAATCCCAGCAGCTCAAGG - Intronic
1015256999 6:131189108-131189130 CAGCCAGTCACAGGATCACAAGG - Intronic
1016417746 6:143850931-143850953 GCACCAAACCCAGCATCACAGGG + Intronic
1019361347 7:605726-605748 GAGCCAAACGCAGGCGCAAAAGG + Intronic
1019608007 7:1919722-1919744 GAGCTGAACCCAAGGTCACATGG + Intronic
1019862407 7:3671986-3672008 GAGCTAAAAGCAGGAACACATGG + Intronic
1021163123 7:17299415-17299437 GACCTAATCCCAGGATCGCAGGG - Intronic
1026834962 7:73632600-73632622 GAGGCACACACAGGAACACAGGG - Intergenic
1026908096 7:74074934-74074956 GAGAAAAACCCAGGACCAGATGG + Intergenic
1027705508 7:81528385-81528407 GAGCCCAACCTAGGAACAGAAGG - Intergenic
1028038371 7:86015452-86015474 GAGCCAACCACAGGCTCAGAGGG - Intergenic
1030172234 7:106615025-106615047 AAACAATACCCAGGATCACACGG - Intergenic
1033648528 7:143322888-143322910 GAGCCAAACACAGGAAAGCAGGG - Intronic
1033992480 7:147305445-147305467 GAGCCAAACCAAGGATTTCTGGG - Intronic
1035847415 8:2880143-2880165 GATCCTGACCCAGGATGACATGG + Intergenic
1037950225 8:23014754-23014776 GAGCCAGTTCCAGGAACACAAGG - Exonic
1038018453 8:23533807-23533829 CAGCCAACACCATGATCACAGGG - Intronic
1040429118 8:47320711-47320733 AAACCAAATCCAGCATCACATGG + Intronic
1042820930 8:72929371-72929393 CAGACATACGCAGGATCACAGGG - Intronic
1043026939 8:75082099-75082121 GAGTGCATCCCAGGATCACATGG + Intergenic
1043204540 8:77420532-77420554 GAGCCAAAGCCTGGCTGACATGG - Intergenic
1044713038 8:95075090-95075112 AAGCAGAACCCAGGGTCACAAGG + Intronic
1045030201 8:98127836-98127858 GAGGCAGAGCCAGGACCACAAGG - Intronic
1047034602 8:120923363-120923385 AAGCCAGACCTAGGATCACTAGG + Intergenic
1047447873 8:124936486-124936508 GAGAGAAGCCAAGGATCACAAGG - Intergenic
1047511948 8:125522128-125522150 GAGCCAAAACCAGGGTGAGAAGG - Intergenic
1049408295 8:142461338-142461360 GAGTCCATCCCAGGTTCACAGGG - Intronic
1050635399 9:7607062-7607084 GTGCCACACCCAGGATCACATGG - Intergenic
1050682642 9:8131644-8131666 GTGCAACACCCAGGATCACCAGG - Intergenic
1052613027 9:30800404-30800426 GAGCAAAATCCAGGAGCACCTGG - Intergenic
1053020658 9:34691707-34691729 GAGGCCACCCCAGGATCTCATGG - Intergenic
1053632790 9:39962846-39962868 GAGCCAAAGCCAGGCTGCCACGG + Intergenic
1053772968 9:41500687-41500709 GAGCCAAAGCCAGGCTGCCACGG - Intergenic
1054142423 9:61540071-61540093 GAGCCAAACCAGGCATCAGAGGG + Intergenic
1054211098 9:62287851-62287873 GAGCCAAAGCCAGGCTGCCACGG - Intergenic
1054752626 9:68923272-68923294 GACAAAAACCCAGGATCACAGGG - Intronic
1056629742 9:88283515-88283537 GGGCCAAATCCAAGATCAAAAGG + Intergenic
1057697300 9:97333483-97333505 AACCCAAACCCAGGACCAAATGG - Intronic
1057883451 9:98809930-98809952 AAGCCAAACCCAGCATGATAAGG + Intronic
1059504058 9:114781931-114781953 AAGGGAAACCCATGATCACAAGG + Intergenic
1060479946 9:124012092-124012114 GCGCCAAAGCCAGGGTCACAAGG - Exonic
1061134171 9:128723884-128723906 GGGCCAATCCCAGGATCTCCAGG + Intronic
1062021729 9:134322762-134322784 GGGCCAGACCCAGGAGCAGAGGG + Intronic
1062167245 9:135113967-135113989 CAGCCACAGCCAGGAACACATGG - Intronic
1203746389 Un_GL000218v1:42681-42703 GAGGCAAACCCAGGGACAGAGGG - Intergenic
1203563719 Un_KI270744v1:76799-76821 GAGGCAAACCCAGGGACAGAAGG + Intergenic
1187007817 X:15249433-15249455 TGGCCAATCCCAAGATCACAGGG + Intronic
1188443791 X:30235981-30236003 GGGTCAGACCCAGGATCACCAGG + Exonic
1189783705 X:44540797-44540819 GAGCCATACCCTGAATTACAGGG + Intronic
1189928612 X:45983688-45983710 GAGCAAAATCCAGGAGCACCTGG + Intergenic
1190993206 X:55574826-55574848 AAGAAAAGCCCAGGATCACATGG + Intergenic
1192358439 X:70424077-70424099 CAGCCAAACCCAGAAGCATAAGG + Intronic
1194044305 X:88983017-88983039 GAACCAAACCCAGGCTGTCACGG + Intergenic
1194159284 X:90431382-90431404 GAACCAAACCCAGGCTGTCATGG + Intergenic
1197617864 X:128714832-128714854 GAGCAAAATCCGGGATCACCTGG + Intergenic
1198995070 X:142565414-142565436 AAGACAAGCCCAGGATCAAATGG - Intergenic
1199316596 X:146385659-146385681 GAGCCCAACCGAGGACCAAATGG - Intergenic
1200270198 X:154675529-154675551 GTGACAAACCCAGGAGCACTGGG - Intronic
1200505585 Y:4008351-4008373 GAACCAAACCCAGGCTGCCATGG + Intergenic
1201159721 Y:11157695-11157717 GAGGCAAACCCAGGGACAGAGGG - Intergenic
1201577163 Y:15473314-15473336 GAGAGAAATCCAGGTTCACAGGG - Intergenic
1201674589 Y:16565208-16565230 AAGACAAACCCAAGATCAAATGG + Intergenic