ID: 1080916587

View in Genome Browser
Species Human (GRCh38)
Location 11:36666508-36666530
Sequence GGCAAGGCCCCTTTAATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080916587_1080916595 15 Left 1080916587 11:36666508-36666530 CCCCCCATTAAAGGGGCCTTGCC No data
Right 1080916595 11:36666546-36666568 TCTTGAGATTCATTTTTTTTAGG No data
1080916587_1080916596 16 Left 1080916587 11:36666508-36666530 CCCCCCATTAAAGGGGCCTTGCC No data
Right 1080916596 11:36666547-36666569 CTTGAGATTCATTTTTTTTAGGG No data
1080916587_1080916598 27 Left 1080916587 11:36666508-36666530 CCCCCCATTAAAGGGGCCTTGCC No data
Right 1080916598 11:36666558-36666580 TTTTTTTTAGGGAGGCACACAGG No data
1080916587_1080916597 19 Left 1080916587 11:36666508-36666530 CCCCCCATTAAAGGGGCCTTGCC No data
Right 1080916597 11:36666550-36666572 GAGATTCATTTTTTTTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080916587 Original CRISPR GGCAAGGCCCCTTTAATGGG GGG (reversed) Intergenic
No off target data available for this crispr