ID: 1080922309

View in Genome Browser
Species Human (GRCh38)
Location 11:36721366-36721388
Sequence TTGGGCGGCCAGAATTATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080922309_1080922315 9 Left 1080922309 11:36721366-36721388 CCTTGATAATTCTGGCCGCCCAA No data
Right 1080922315 11:36721398-36721420 GCTTTGAATGCATTCCAAGAAGG No data
1080922309_1080922316 21 Left 1080922309 11:36721366-36721388 CCTTGATAATTCTGGCCGCCCAA No data
Right 1080922316 11:36721410-36721432 TTCCAAGAAGGCACGTGAGCTGG No data
1080922309_1080922318 30 Left 1080922309 11:36721366-36721388 CCTTGATAATTCTGGCCGCCCAA No data
Right 1080922318 11:36721419-36721441 GGCACGTGAGCTGGCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080922309 Original CRISPR TTGGGCGGCCAGAATTATCA AGG (reversed) Intergenic
No off target data available for this crispr