ID: 1080925182

View in Genome Browser
Species Human (GRCh38)
Location 11:36748811-36748833
Sequence CTGTGTGGCCTTAAGCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080925182_1080925186 0 Left 1080925182 11:36748811-36748833 CCAACTTGCTTAAGGCCACACAG No data
Right 1080925186 11:36748834-36748856 TGAGTAAATGGCAAAATTCAGGG No data
1080925182_1080925185 -1 Left 1080925182 11:36748811-36748833 CCAACTTGCTTAAGGCCACACAG No data
Right 1080925185 11:36748833-36748855 GTGAGTAAATGGCAAAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080925182 Original CRISPR CTGTGTGGCCTTAAGCAAGT TGG (reversed) Intergenic
No off target data available for this crispr