ID: 1080925556

View in Genome Browser
Species Human (GRCh38)
Location 11:36752542-36752564
Sequence CTGTGGTCCTATGTCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080925554_1080925556 4 Left 1080925554 11:36752515-36752537 CCTAGATCTGTAAAAATGTTTTA No data
Right 1080925556 11:36752542-36752564 CTGTGGTCCTATGTCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080925556 Original CRISPR CTGTGGTCCTATGTCTCTGC TGG Intergenic
No off target data available for this crispr