ID: 1080931452

View in Genome Browser
Species Human (GRCh38)
Location 11:36815746-36815768
Sequence CCTTATAAGAAGACAGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080931448_1080931452 -9 Left 1080931448 11:36815732-36815754 CCAATGTCCAGTGTCCTTATAAG No data
Right 1080931452 11:36815746-36815768 CCTTATAAGAAGACAGAGAAGGG No data
1080931447_1080931452 16 Left 1080931447 11:36815707-36815729 CCTGGATTTAGGGTGGTCTCTAA No data
Right 1080931452 11:36815746-36815768 CCTTATAAGAAGACAGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080931452 Original CRISPR CCTTATAAGAAGACAGAGAA GGG Intergenic
No off target data available for this crispr