ID: 1080931527

View in Genome Browser
Species Human (GRCh38)
Location 11:36816639-36816661
Sequence ATGTATCAGCCTCCTCCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080931526_1080931527 2 Left 1080931526 11:36816614-36816636 CCTCATTATATGGAAATAGTACT No data
Right 1080931527 11:36816639-36816661 ATGTATCAGCCTCCTCCATTAGG No data
1080931524_1080931527 16 Left 1080931524 11:36816600-36816622 CCAGCACACATATACCTCATTAT No data
Right 1080931527 11:36816639-36816661 ATGTATCAGCCTCCTCCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080931527 Original CRISPR ATGTATCAGCCTCCTCCATT AGG Intergenic
No off target data available for this crispr