ID: 1080932701

View in Genome Browser
Species Human (GRCh38)
Location 11:36829359-36829381
Sequence AGGGAAACTACCATCAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080932701_1080932702 -10 Left 1080932701 11:36829359-36829381 CCTTCTCTGATGGTAGTTTCCCT No data
Right 1080932702 11:36829372-36829394 TAGTTTCCCTGCACTGCATCTGG No data
1080932701_1080932703 -9 Left 1080932701 11:36829359-36829381 CCTTCTCTGATGGTAGTTTCCCT No data
Right 1080932703 11:36829373-36829395 AGTTTCCCTGCACTGCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080932701 Original CRISPR AGGGAAACTACCATCAGAGA AGG (reversed) Intergenic
No off target data available for this crispr