ID: 1080932702

View in Genome Browser
Species Human (GRCh38)
Location 11:36829372-36829394
Sequence TAGTTTCCCTGCACTGCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080932701_1080932702 -10 Left 1080932701 11:36829359-36829381 CCTTCTCTGATGGTAGTTTCCCT No data
Right 1080932702 11:36829372-36829394 TAGTTTCCCTGCACTGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080932702 Original CRISPR TAGTTTCCCTGCACTGCATC TGG Intergenic
No off target data available for this crispr