ID: 1080953880

View in Genome Browser
Species Human (GRCh38)
Location 11:37069554-37069576
Sequence AAAATGTGCCTTTTAGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080953877_1080953880 7 Left 1080953877 11:37069524-37069546 CCCATTTCACTACATACTTACAG No data
Right 1080953880 11:37069554-37069576 AAAATGTGCCTTTTAGATATAGG No data
1080953876_1080953880 18 Left 1080953876 11:37069513-37069535 CCTTCTCATTACCCATTTCACTA No data
Right 1080953880 11:37069554-37069576 AAAATGTGCCTTTTAGATATAGG No data
1080953878_1080953880 6 Left 1080953878 11:37069525-37069547 CCATTTCACTACATACTTACAGG No data
Right 1080953880 11:37069554-37069576 AAAATGTGCCTTTTAGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080953880 Original CRISPR AAAATGTGCCTTTTAGATAT AGG Intergenic
No off target data available for this crispr