ID: 1080957818

View in Genome Browser
Species Human (GRCh38)
Location 11:37121242-37121264
Sequence CTCATTTTCTTAAGGACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080957818_1080957822 -3 Left 1080957818 11:37121242-37121264 CCCTTTGTCCTTAAGAAAATGAG No data
Right 1080957822 11:37121262-37121284 GAGGAATCCATGAACAGATTTGG No data
1080957818_1080957824 12 Left 1080957818 11:37121242-37121264 CCCTTTGTCCTTAAGAAAATGAG No data
Right 1080957824 11:37121277-37121299 AGATTTGGAACAATTAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080957818 Original CRISPR CTCATTTTCTTAAGGACAAA GGG (reversed) Intergenic
No off target data available for this crispr