ID: 1080959105

View in Genome Browser
Species Human (GRCh38)
Location 11:37137061-37137083
Sequence CTGACAAATTACCTTTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080959105_1080959108 1 Left 1080959105 11:37137061-37137083 CCATCAAAAAGGTAATTTGTCAG No data
Right 1080959108 11:37137085-37137107 ATCAATTAGGCTTTATTCCTGGG No data
1080959105_1080959107 0 Left 1080959105 11:37137061-37137083 CCATCAAAAAGGTAATTTGTCAG No data
Right 1080959107 11:37137084-37137106 TATCAATTAGGCTTTATTCCTGG No data
1080959105_1080959109 12 Left 1080959105 11:37137061-37137083 CCATCAAAAAGGTAATTTGTCAG No data
Right 1080959109 11:37137096-37137118 TTTATTCCTGGGATACAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080959105 Original CRISPR CTGACAAATTACCTTTTTGA TGG (reversed) Intergenic
No off target data available for this crispr