ID: 1080961969

View in Genome Browser
Species Human (GRCh38)
Location 11:37171386-37171408
Sequence GTGTGCGTGTGGTTGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080961965_1080961969 -1 Left 1080961965 11:37171364-37171386 CCTGATAATTATTTGTGTGTGTG No data
Right 1080961969 11:37171386-37171408 GTGTGCGTGTGGTTGGAAGAGGG No data
1080961964_1080961969 10 Left 1080961964 11:37171353-37171375 CCTGTTTTGAGCCTGATAATTAT No data
Right 1080961969 11:37171386-37171408 GTGTGCGTGTGGTTGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080961969 Original CRISPR GTGTGCGTGTGGTTGGAAGA GGG Intergenic
No off target data available for this crispr