ID: 1080967355

View in Genome Browser
Species Human (GRCh38)
Location 11:37228588-37228610
Sequence CTGTTTCAGAGGCAAGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080967355_1080967358 -2 Left 1080967355 11:37228588-37228610 CCTGTCACTTGCCTCTGAAACAG No data
Right 1080967358 11:37228609-37228631 AGAAAAGAAGCAAGCTTTTTGGG No data
1080967355_1080967359 3 Left 1080967355 11:37228588-37228610 CCTGTCACTTGCCTCTGAAACAG No data
Right 1080967359 11:37228614-37228636 AGAAGCAAGCTTTTTGGGATAGG No data
1080967355_1080967360 29 Left 1080967355 11:37228588-37228610 CCTGTCACTTGCCTCTGAAACAG No data
Right 1080967360 11:37228640-37228662 GTTACACACCTGTACTTTCCTGG No data
1080967355_1080967361 30 Left 1080967355 11:37228588-37228610 CCTGTCACTTGCCTCTGAAACAG No data
Right 1080967361 11:37228641-37228663 TTACACACCTGTACTTTCCTGGG No data
1080967355_1080967357 -3 Left 1080967355 11:37228588-37228610 CCTGTCACTTGCCTCTGAAACAG No data
Right 1080967357 11:37228608-37228630 CAGAAAAGAAGCAAGCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080967355 Original CRISPR CTGTTTCAGAGGCAAGTGAC AGG (reversed) Intergenic
No off target data available for this crispr