ID: 1080976682

View in Genome Browser
Species Human (GRCh38)
Location 11:37350608-37350630
Sequence GACAGCTTTTGGCTTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080976678_1080976682 15 Left 1080976678 11:37350570-37350592 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 1080976682 11:37350608-37350630 GACAGCTTTTGGCTTGTTACTGG No data
1080976679_1080976682 11 Left 1080976679 11:37350574-37350596 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1080976682 11:37350608-37350630 GACAGCTTTTGGCTTGTTACTGG No data
1080976677_1080976682 16 Left 1080976677 11:37350569-37350591 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 1080976682 11:37350608-37350630 GACAGCTTTTGGCTTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080976682 Original CRISPR GACAGCTTTTGGCTTGTTAC TGG Intergenic
No off target data available for this crispr