ID: 1080977888

View in Genome Browser
Species Human (GRCh38)
Location 11:37364294-37364316
Sequence GTCTCCATGGGGAAAGCTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080977879_1080977888 28 Left 1080977879 11:37364243-37364265 CCTGCTTCTTGGGCATACTAGGA No data
Right 1080977888 11:37364294-37364316 GTCTCCATGGGGAAAGCTTGCGG No data
1080977883_1080977888 -4 Left 1080977883 11:37364275-37364297 CCTGAAAGCCACAGTTTCTGTCT No data
Right 1080977888 11:37364294-37364316 GTCTCCATGGGGAAAGCTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080977888 Original CRISPR GTCTCCATGGGGAAAGCTTG CGG Intergenic
No off target data available for this crispr