ID: 1080990878

View in Genome Browser
Species Human (GRCh38)
Location 11:37533274-37533296
Sequence GGTCTTATTGGACCCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080990878_1080990881 6 Left 1080990878 11:37533274-37533296 CCTGGGTGGGGTCCAATAAGACC No data
Right 1080990881 11:37533303-37533325 GCCAGTTTATCAGTCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080990878 Original CRISPR GGTCTTATTGGACCCCACCC AGG (reversed) Intergenic
No off target data available for this crispr