ID: 1080992106

View in Genome Browser
Species Human (GRCh38)
Location 11:37549283-37549305
Sequence GGTACGTAGTTAATTGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080992106_1080992112 19 Left 1080992106 11:37549283-37549305 CCGGCAGCAATTAACTACGTACC No data
Right 1080992112 11:37549325-37549347 ATTTCCTTCATTTTGTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080992106 Original CRISPR GGTACGTAGTTAATTGCTGC CGG (reversed) Intergenic
No off target data available for this crispr