ID: 1080992640

View in Genome Browser
Species Human (GRCh38)
Location 11:37557916-37557938
Sequence TTTCACAGCTTGAAAAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080992640_1080992643 -8 Left 1080992640 11:37557916-37557938 CCCCTTTTTTTCAAGCTGTGAAA No data
Right 1080992643 11:37557931-37557953 CTGTGAAAATCTATTTATGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080992640 Original CRISPR TTTCACAGCTTGAAAAAAAG GGG (reversed) Intergenic
No off target data available for this crispr