ID: 1080994255

View in Genome Browser
Species Human (GRCh38)
Location 11:37580802-37580824
Sequence CTGTGTGGGCAAAAGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080994248_1080994255 12 Left 1080994248 11:37580767-37580789 CCTGGAAGAACTACCTTCAGTAA No data
Right 1080994255 11:37580802-37580824 CTGTGTGGGCAAAAGGAAAGAGG No data
1080994250_1080994255 -1 Left 1080994250 11:37580780-37580802 CCTTCAGTAAACCAAGTGTGGTC 0: 2
1: 18
2: 223
3: 211
4: 445
Right 1080994255 11:37580802-37580824 CTGTGTGGGCAAAAGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080994255 Original CRISPR CTGTGTGGGCAAAAGGAAAG AGG Intergenic
No off target data available for this crispr