ID: 1080997171

View in Genome Browser
Species Human (GRCh38)
Location 11:37618383-37618405
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1080997168_1080997171 4 Left 1080997168 11:37618356-37618378 CCTAGAAACTTGTTGAATGGTTG No data
Right 1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1080997171 Original CRISPR CAAAATACTGATAGTAACAT GGG Intergenic