ID: 1081000188

View in Genome Browser
Species Human (GRCh38)
Location 11:37659739-37659761
Sequence GTGGGGTGGGGGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17134
Summary {0: 3, 1: 266, 2: 469, 3: 2261, 4: 14135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081000188 Original CRISPR GTGGGGTGGGGGAGGGTGGA GGG Intergenic
Too many off-targets to display for this crispr