ID: 1081001754

View in Genome Browser
Species Human (GRCh38)
Location 11:37682418-37682440
Sequence ATATCCTGCTTCACTAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081001754_1081001766 27 Left 1081001754 11:37682418-37682440 CCTATCTTAGTGAAGCAGGATAT No data
Right 1081001766 11:37682468-37682490 TAGAGTGCACGGGTGTTGGCAGG No data
1081001754_1081001767 30 Left 1081001754 11:37682418-37682440 CCTATCTTAGTGAAGCAGGATAT No data
Right 1081001767 11:37682471-37682493 AGTGCACGGGTGTTGGCAGGAGG No data
1081001754_1081001765 23 Left 1081001754 11:37682418-37682440 CCTATCTTAGTGAAGCAGGATAT No data
Right 1081001765 11:37682464-37682486 GAACTAGAGTGCACGGGTGTTGG No data
1081001754_1081001756 -3 Left 1081001754 11:37682418-37682440 CCTATCTTAGTGAAGCAGGATAT No data
Right 1081001756 11:37682438-37682460 TATTTCCCTGACCCCTTCATGGG No data
1081001754_1081001764 17 Left 1081001754 11:37682418-37682440 CCTATCTTAGTGAAGCAGGATAT No data
Right 1081001764 11:37682458-37682480 GGGCAGGAACTAGAGTGCACGGG No data
1081001754_1081001763 16 Left 1081001754 11:37682418-37682440 CCTATCTTAGTGAAGCAGGATAT No data
Right 1081001763 11:37682457-37682479 TGGGCAGGAACTAGAGTGCACGG No data
1081001754_1081001757 1 Left 1081001754 11:37682418-37682440 CCTATCTTAGTGAAGCAGGATAT No data
Right 1081001757 11:37682442-37682464 TCCCTGACCCCTTCATGGGCAGG No data
1081001754_1081001755 -4 Left 1081001754 11:37682418-37682440 CCTATCTTAGTGAAGCAGGATAT No data
Right 1081001755 11:37682437-37682459 ATATTTCCCTGACCCCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081001754 Original CRISPR ATATCCTGCTTCACTAAGAT AGG (reversed) Intergenic