ID: 1081007133

View in Genome Browser
Species Human (GRCh38)
Location 11:37758709-37758731
Sequence TGGTAGTGATTACAGAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081007131_1081007133 4 Left 1081007131 11:37758682-37758704 CCTTCAAAGTGAGTTTCATAATT No data
Right 1081007133 11:37758709-37758731 TGGTAGTGATTACAGAACAGAGG No data
1081007130_1081007133 5 Left 1081007130 11:37758681-37758703 CCCTTCAAAGTGAGTTTCATAAT No data
Right 1081007133 11:37758709-37758731 TGGTAGTGATTACAGAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081007133 Original CRISPR TGGTAGTGATTACAGAACAG AGG Intergenic