ID: 1081008612

View in Genome Browser
Species Human (GRCh38)
Location 11:37779725-37779747
Sequence ATCCCATGAGCTTCTCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081008612_1081008617 0 Left 1081008612 11:37779725-37779747 CCTCTTTGAGAAGCTCATGGGAT No data
Right 1081008617 11:37779748-37779770 AGGGGTTTGCATGTTGAATAGGG No data
1081008612_1081008616 -1 Left 1081008612 11:37779725-37779747 CCTCTTTGAGAAGCTCATGGGAT No data
Right 1081008616 11:37779747-37779769 TAGGGGTTTGCATGTTGAATAGG No data
1081008612_1081008618 14 Left 1081008612 11:37779725-37779747 CCTCTTTGAGAAGCTCATGGGAT No data
Right 1081008618 11:37779762-37779784 TGAATAGGGAATGAATAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081008612 Original CRISPR ATCCCATGAGCTTCTCAAAG AGG (reversed) Intergenic