ID: 1081012025

View in Genome Browser
Species Human (GRCh38)
Location 11:37825453-37825475
Sequence ATGTCTAAAAGGTTTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081012025_1081012029 -8 Left 1081012025 11:37825453-37825475 CCTTCCACAAACCTTTTAGACAT No data
Right 1081012029 11:37825468-37825490 TTAGACATAGTGGATACATGTGG No data
1081012025_1081012030 1 Left 1081012025 11:37825453-37825475 CCTTCCACAAACCTTTTAGACAT No data
Right 1081012030 11:37825477-37825499 GTGGATACATGTGGAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081012025 Original CRISPR ATGTCTAAAAGGTTTGTGGA AGG (reversed) Intergenic
No off target data available for this crispr