ID: 1081012030

View in Genome Browser
Species Human (GRCh38)
Location 11:37825477-37825499
Sequence GTGGATACATGTGGAATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081012026_1081012030 -3 Left 1081012026 11:37825457-37825479 CCACAAACCTTTTAGACATAGTG No data
Right 1081012030 11:37825477-37825499 GTGGATACATGTGGAATAAATGG No data
1081012023_1081012030 6 Left 1081012023 11:37825448-37825470 CCCTTCCTTCCACAAACCTTTTA No data
Right 1081012030 11:37825477-37825499 GTGGATACATGTGGAATAAATGG No data
1081012025_1081012030 1 Left 1081012025 11:37825453-37825475 CCTTCCACAAACCTTTTAGACAT No data
Right 1081012030 11:37825477-37825499 GTGGATACATGTGGAATAAATGG No data
1081012024_1081012030 5 Left 1081012024 11:37825449-37825471 CCTTCCTTCCACAAACCTTTTAG No data
Right 1081012030 11:37825477-37825499 GTGGATACATGTGGAATAAATGG No data
1081012022_1081012030 30 Left 1081012022 11:37825424-37825446 CCTCTTATTTTAAATTTTTATTT No data
Right 1081012030 11:37825477-37825499 GTGGATACATGTGGAATAAATGG No data
1081012028_1081012030 -10 Left 1081012028 11:37825464-37825486 CCTTTTAGACATAGTGGATACAT No data
Right 1081012030 11:37825477-37825499 GTGGATACATGTGGAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081012030 Original CRISPR GTGGATACATGTGGAATAAA TGG Intergenic
No off target data available for this crispr