ID: 1081016036

View in Genome Browser
Species Human (GRCh38)
Location 11:37882126-37882148
Sequence CCCAAAAATAAGTGTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081016036_1081016040 25 Left 1081016036 11:37882126-37882148 CCTGTTTTACACTTATTTTTGGG No data
Right 1081016040 11:37882174-37882196 CAATCAAATCCAGAAGGCAGAGG No data
1081016036_1081016039 19 Left 1081016036 11:37882126-37882148 CCTGTTTTACACTTATTTTTGGG No data
Right 1081016039 11:37882168-37882190 TTTTTGCAATCAAATCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081016036 Original CRISPR CCCAAAAATAAGTGTAAAAC AGG (reversed) Intergenic
No off target data available for this crispr