ID: 1081018872

View in Genome Browser
Species Human (GRCh38)
Location 11:37917692-37917714
Sequence ATCTATAACCAAATTCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081018870_1081018872 15 Left 1081018870 11:37917654-37917676 CCTACAAATTATCTTTAATTTCT No data
Right 1081018872 11:37917692-37917714 ATCTATAACCAAATTCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081018872 Original CRISPR ATCTATAACCAAATTCTTGT TGG Intergenic
No off target data available for this crispr