ID: 1081019160

View in Genome Browser
Species Human (GRCh38)
Location 11:37921837-37921859
Sequence TTTACCTTCTATGCATGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081019158_1081019160 -9 Left 1081019158 11:37921823-37921845 CCTGCCTCTTTCTGTTTACCTTC No data
Right 1081019160 11:37921837-37921859 TTTACCTTCTATGCATGTATAGG No data
1081019157_1081019160 -8 Left 1081019157 11:37921822-37921844 CCCTGCCTCTTTCTGTTTACCTT No data
Right 1081019160 11:37921837-37921859 TTTACCTTCTATGCATGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081019160 Original CRISPR TTTACCTTCTATGCATGTAT AGG Intergenic
No off target data available for this crispr