ID: 1081026201

View in Genome Browser
Species Human (GRCh38)
Location 11:38018658-38018680
Sequence CAGTTTTTGGATCTTGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081026201_1081026205 25 Left 1081026201 11:38018658-38018680 CCTTATACAAGATCCAAAAACTG No data
Right 1081026205 11:38018706-38018728 AATGAATAATAAAGAATATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081026201 Original CRISPR CAGTTTTTGGATCTTGTATA AGG (reversed) Intergenic
No off target data available for this crispr