ID: 1081034485

View in Genome Browser
Species Human (GRCh38)
Location 11:38125121-38125143
Sequence TGGAATTATTCCAATAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081034485_1081034489 18 Left 1081034485 11:38125121-38125143 CCCACTCTATTGGAATAATTCCA No data
Right 1081034489 11:38125162-38125184 GAAATGAAACCTTCAATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081034485 Original CRISPR TGGAATTATTCCAATAGAGT GGG (reversed) Intergenic
No off target data available for this crispr