ID: 1081040290 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:38201457-38201479 |
Sequence | TTCTGATTTGTGATCTCCTT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1081040290_1081040293 | 19 | Left | 1081040290 | 11:38201457-38201479 | CCAAAGGAGATCACAAATCAGAA | No data | ||
Right | 1081040293 | 11:38201499-38201521 | CAGCAGCATCATGCTGTAGGAGG | No data | ||||
1081040290_1081040292 | 16 | Left | 1081040290 | 11:38201457-38201479 | CCAAAGGAGATCACAAATCAGAA | No data | ||
Right | 1081040292 | 11:38201496-38201518 | ATTCAGCAGCATCATGCTGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1081040290 | Original CRISPR | TTCTGATTTGTGATCTCCTT TGG (reversed) | Intergenic | ||