ID: 1081040290

View in Genome Browser
Species Human (GRCh38)
Location 11:38201457-38201479
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081040290_1081040292 16 Left 1081040290 11:38201457-38201479 CCAAAGGAGATCACAAATCAGAA No data
Right 1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG No data
1081040290_1081040293 19 Left 1081040290 11:38201457-38201479 CCAAAGGAGATCACAAATCAGAA No data
Right 1081040293 11:38201499-38201521 CAGCAGCATCATGCTGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081040290 Original CRISPR TTCTGATTTGTGATCTCCTT TGG (reversed) Intergenic