ID: 1081040292

View in Genome Browser
Species Human (GRCh38)
Location 11:38201496-38201518
Sequence ATTCAGCAGCATCATGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081040290_1081040292 16 Left 1081040290 11:38201457-38201479 CCAAAGGAGATCACAAATCAGAA No data
Right 1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081040292 Original CRISPR ATTCAGCAGCATCATGCTGT AGG Intergenic
No off target data available for this crispr