ID: 1081041846

View in Genome Browser
Species Human (GRCh38)
Location 11:38223338-38223360
Sequence GGTCCAGCCCTGATATTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081041843_1081041846 -9 Left 1081041843 11:38223324-38223346 CCTCCTCTTGCAGAGGTCCAGCC No data
Right 1081041846 11:38223338-38223360 GGTCCAGCCCTGATATTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081041846 Original CRISPR GGTCCAGCCCTGATATTTGG TGG Intergenic
No off target data available for this crispr