ID: 1081042492

View in Genome Browser
Species Human (GRCh38)
Location 11:38228613-38228635
Sequence CCTTCAGACCATGAGTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081042489_1081042492 -8 Left 1081042489 11:38228598-38228620 CCATCCTACTCTAGACCTTCAGA No data
Right 1081042492 11:38228613-38228635 CCTTCAGACCATGAGTTGTCTGG No data
1081042488_1081042492 16 Left 1081042488 11:38228574-38228596 CCTAAGAAGTTGGAATTGATTTT No data
Right 1081042492 11:38228613-38228635 CCTTCAGACCATGAGTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081042492 Original CRISPR CCTTCAGACCATGAGTTGTC TGG Intergenic
No off target data available for this crispr