ID: 1081049996

View in Genome Browser
Species Human (GRCh38)
Location 11:38326982-38327004
Sequence CTAGTTGTATAAACTTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081049993_1081049996 -8 Left 1081049993 11:38326967-38326989 CCGGCCTTCGACTTACTAGTTGT No data
Right 1081049996 11:38326982-38327004 CTAGTTGTATAAACTTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081049996 Original CRISPR CTAGTTGTATAAACTTGAGG AGG Intergenic
No off target data available for this crispr