ID: 1081053817

View in Genome Browser
Species Human (GRCh38)
Location 11:38382844-38382866
Sequence CATTCTTTATGCCCTGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081053817_1081053820 -6 Left 1081053817 11:38382844-38382866 CCTCCATCAGGGCATAAAGAATG No data
Right 1081053820 11:38382861-38382883 AGAATGACATTATAAAAGTTGGG No data
1081053817_1081053819 -7 Left 1081053817 11:38382844-38382866 CCTCCATCAGGGCATAAAGAATG No data
Right 1081053819 11:38382860-38382882 AAGAATGACATTATAAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081053817 Original CRISPR CATTCTTTATGCCCTGATGG AGG (reversed) Intergenic
No off target data available for this crispr