ID: 1081056151

View in Genome Browser
Species Human (GRCh38)
Location 11:38413088-38413110
Sequence TCTAAGCTTTACCAAGTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081056151_1081056157 24 Left 1081056151 11:38413088-38413110 CCTTAAACTTGGTAAAGCTTAGA No data
Right 1081056157 11:38413135-38413157 TAGTTAGCCACCATAAACTAGGG No data
1081056151_1081056156 23 Left 1081056151 11:38413088-38413110 CCTTAAACTTGGTAAAGCTTAGA No data
Right 1081056156 11:38413134-38413156 ATAGTTAGCCACCATAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081056151 Original CRISPR TCTAAGCTTTACCAAGTTTA AGG (reversed) Intergenic
No off target data available for this crispr