ID: 1081057206

View in Genome Browser
Species Human (GRCh38)
Location 11:38424756-38424778
Sequence CAGAATAAGGTGACGTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081057204_1081057206 0 Left 1081057204 11:38424733-38424755 CCAGCATGGCTAGAAAAAGCAGT No data
Right 1081057206 11:38424756-38424778 CAGAATAAGGTGACGTAAGCTGG No data
1081057201_1081057206 15 Left 1081057201 11:38424718-38424740 CCATCCAATGGGCTTCCAGCATG No data
Right 1081057206 11:38424756-38424778 CAGAATAAGGTGACGTAAGCTGG No data
1081057203_1081057206 11 Left 1081057203 11:38424722-38424744 CCAATGGGCTTCCAGCATGGCTA No data
Right 1081057206 11:38424756-38424778 CAGAATAAGGTGACGTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081057206 Original CRISPR CAGAATAAGGTGACGTAAGC TGG Intergenic
No off target data available for this crispr