ID: 1081059941

View in Genome Browser
Species Human (GRCh38)
Location 11:38461876-38461898
Sequence TTGGAAACGCACACCCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081059941_1081059944 30 Left 1081059941 11:38461876-38461898 CCCAGATGGGTGTGCGTTTCCAA No data
Right 1081059944 11:38461929-38461951 TTATGTGTTAATCAGCTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081059941 Original CRISPR TTGGAAACGCACACCCATCT GGG (reversed) Intergenic