ID: 1081063030

View in Genome Browser
Species Human (GRCh38)
Location 11:38503995-38504017
Sequence CCACAATCAGCAGTGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081063030_1081063039 24 Left 1081063030 11:38503995-38504017 CCATCCCCCACTGCTGATTGTGG No data
Right 1081063039 11:38504042-38504064 TCCACCCCTCTGGATCCAGCAGG 0: 7
1: 55
2: 94
3: 138
4: 303
1081063030_1081063037 14 Left 1081063030 11:38503995-38504017 CCATCCCCCACTGCTGATTGTGG No data
Right 1081063037 11:38504032-38504054 GCCGCTGACTTCCACCCCTCTGG 0: 21
1: 71
2: 115
3: 97
4: 145
1081063030_1081063042 26 Left 1081063030 11:38503995-38504017 CCATCCCCCACTGCTGATTGTGG No data
Right 1081063042 11:38504044-38504066 CACCCCTCTGGATCCAGCAGGGG No data
1081063030_1081063041 25 Left 1081063030 11:38503995-38504017 CCATCCCCCACTGCTGATTGTGG No data
Right 1081063041 11:38504043-38504065 CCACCCCTCTGGATCCAGCAGGG 0: 9
1: 51
2: 111
3: 141
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081063030 Original CRISPR CCACAATCAGCAGTGGGGGA TGG (reversed) Intergenic
No off target data available for this crispr