ID: 1081065459

View in Genome Browser
Species Human (GRCh38)
Location 11:38534866-38534888
Sequence GGCAGCTCTTGGCTTGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081065459_1081065465 16 Left 1081065459 11:38534866-38534888 CCAATAACAAGCCAAGAGCTGCC No data
Right 1081065465 11:38534905-38534927 GTTGTCTGCAGGAGATGGCAGGG No data
1081065459_1081065464 15 Left 1081065459 11:38534866-38534888 CCAATAACAAGCCAAGAGCTGCC No data
Right 1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG No data
1081065459_1081065462 5 Left 1081065459 11:38534866-38534888 CCAATAACAAGCCAAGAGCTGCC No data
Right 1081065462 11:38534894-38534916 AAAAGACAGTAGTTGTCTGCAGG No data
1081065459_1081065463 11 Left 1081065459 11:38534866-38534888 CCAATAACAAGCCAAGAGCTGCC No data
Right 1081065463 11:38534900-38534922 CAGTAGTTGTCTGCAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081065459 Original CRISPR GGCAGCTCTTGGCTTGTTAT TGG (reversed) Intergenic
No off target data available for this crispr