ID: 1081065464

View in Genome Browser
Species Human (GRCh38)
Location 11:38534904-38534926
Sequence AGTTGTCTGCAGGAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081065459_1081065464 15 Left 1081065459 11:38534866-38534888 CCAATAACAAGCCAAGAGCTGCC No data
Right 1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG No data
1081065458_1081065464 16 Left 1081065458 11:38534865-38534887 CCCAATAACAAGCCAAGAGCTGC No data
Right 1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG No data
1081065456_1081065464 25 Left 1081065456 11:38534856-38534878 CCACCGAAGCCCAATAACAAGCC No data
Right 1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG No data
1081065457_1081065464 22 Left 1081065457 11:38534859-38534881 CCGAAGCCCAATAACAAGCCAAG No data
Right 1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG No data
1081065460_1081065464 4 Left 1081065460 11:38534877-38534899 CCAAGAGCTGCCTCTCAAAAAGA No data
Right 1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG No data
1081065461_1081065464 -6 Left 1081065461 11:38534887-38534909 CCTCTCAAAAAGACAGTAGTTGT No data
Right 1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081065464 Original CRISPR AGTTGTCTGCAGGAGATGGC AGG Intergenic
No off target data available for this crispr