ID: 1081065781

View in Genome Browser
Species Human (GRCh38)
Location 11:38537333-38537355
Sequence GGTCACGGAGATGGCTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081065774_1081065781 17 Left 1081065774 11:38537293-38537315 CCAGGACTTTAGTCTAGTTATAG 0: 53
1: 70
2: 42
3: 37
4: 98
Right 1081065781 11:38537333-38537355 GGTCACGGAGATGGCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081065781 Original CRISPR GGTCACGGAGATGGCTCCTG AGG Intergenic
No off target data available for this crispr