ID: 1081069741

View in Genome Browser
Species Human (GRCh38)
Location 11:38595865-38595887
Sequence CAGCAAATAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081069731_1081069741 24 Left 1081069731 11:38595818-38595840 CCCTGCTGGATCCAGAGGGATGG No data
Right 1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG No data
1081069733_1081069741 23 Left 1081069733 11:38595819-38595841 CCTGCTGGATCCAGAGGGATGGA 0: 14
1: 44
2: 107
3: 135
4: 303
Right 1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG No data
1081069734_1081069741 13 Left 1081069734 11:38595829-38595851 CCAGAGGGATGGAAGTCAGCAGC 0: 14
1: 58
2: 95
3: 108
4: 250
Right 1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081069741 Original CRISPR CAGCAAATAGCAGTGGTGGA TGG Intergenic
No off target data available for this crispr